1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timama [110]
3 years ago
15

How do you calculate the adjusted amount of energy that is available to organisms that are one trophic level above producers

Biology
2 answers:
ki77a [65]3 years ago
5 0

Answer:

gross primary productivity minus amount of organic material used in respiration

Explanation:

Got a 100% :)

Oduvanchick [21]3 years ago
3 0

Answer:

1. B- gross primary productivity minus amount of organic material...

2. D- Increases

3. B- by observing cellular respiration under the absence of light

4. D- dead organisms and waste are recycled throughout the trophic levels.

5. C- the rate that plants and other photosynthetic...

Explanation:

<em>Life Processes Quick Check</em>

Got 100% <3

You might be interested in
Fill in the blank
const2013 [10]
The answer is mass my friend


7 0
2 years ago
Read 2 more answers
Why is the sky blue during the day every single day of the year
vladimir2022 [97]
The sky is blue due to Rayleigh scattering.

Particles in our atmosphere split the white light that the sun emits to the shortest wave length
(Blue)

Skies becomes red during the sunset since an angle forces the light to travel through more dust particles making it a longer wavelength
(Red)

Water in the clouds are not small enough to split light into a specific colour so it remains the same
(White)

I would appreciate a brainliest.
6 0
3 years ago
Read 2 more answers
Metamorphosis is a type of homeostasis. <br> a. True<br> b. False
Vsevolod [243]
Metamorphosis is a type of homeostasis. A. is the correct answer.
4 0
3 years ago
The organelles that produce proteins used within the cell are the _____.?
Butoxors [25]
Nucleus, ribosomes, endoplasmic reticulum, and <span>Golgi apparatus.</span>
8 0
2 years ago
Read 2 more answers
Type the answer through sentences please and thank you
Nonamiya [84]

In order for plants to make their own food, they must go through a process called photosynthesis. This process occurs in the chloroplasts of a cell. To begin this process, all items needed must go to the cells of a plant. Water and nutrient are absorbed from the soil through the roots. A tube called the xylem carries only water up the stem to the rest of the plant. Gas exchange in the plants occur in the tiny pores of a leaf called the stomata. This is opened and closed by the guard cells. The food produced by this process is called ATP and it is a macromolecule known as a nucleic acid.

5 0
3 years ago
Other questions:
  • Low calcium levels in the blood can be raised by dissolving bone tissue. Which cell would most likely be involved in this proces
    11·1 answer
  • Why is DNA called the blueprint of life?
    10·1 answer
  • The first line of medical care in great britain is the:
    9·1 answer
  • A secondary consumer eats
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Predict the effects of a superficial injury to the spinocerebellar tracts.
    12·1 answer
  • What are the reaming parts bacteria work on
    14·1 answer
  • 1. What are El Niño and La Niña characterized by??
    10·2 answers
  • How your innate immunity protects you from the pathogens you encounter.
    12·1 answer
  • Does anybody know the answer to this question I really really need help
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!