1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shusha [124]
2 years ago
11

Which category of tissue (epithelial, nervous, muscle, or connective) is melanin part of?

Biology
1 answer:
Rasek [7]2 years ago
6 0

Answer:

Melanin is part of the epithelial

You might be interested in
Which bonds are found inside a water molecule, between hydrogen and oxygen?
VikaD [51]

Answer:

Hydrogen Bonding in Water (1) The hydrogen bond in water is a dynamic attraction between neighboring water molecules involving one hydrogen atom located between the two oxygen atoms.

Explanation:

6 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
NEED BIO HELP ASAP 30 POINTS !!!!!!!!!!!!!!!!!!!!!!
alexandr402 [8]

1. Cell starts into mitosis phase of the cell cycle.

2. Helicase begins to break the hydrogen bonds between the nitrogen bases. (The double helix has to be unwound in order to expose the nucleotides)

3. DNA polymerase attach the free-floating nucleotides to the exposed nitrogen bases. (this allows a new DNA strand to be made on the existing one)

4. Free floating nucleotides pair up with exposed nitrogen bases (this is what really builds the new strand, based around the template strand)

5. Two new molecules of DNA are created

Statements:

Adenine

Cytosine (Car in the Garage, Apple in a Tree is a good trick to know how they pair)

DNA

Replication

Double helix

4 0
3 years ago
The light dependent reactions take place in thea)matrix of the mitochondria.
Marrrta [24]
D: The reactions take place in the thylakoid of the chloroplast.
3 0
2 years ago
Read 2 more answers
Please help me. the first person to answer correctly will get a brainlist
iragen [17]
NSF international because it’s the public health and safety organization
3 0
2 years ago
Read 2 more answers
Other questions:
  • Who discovered the impermanence of sexual phenotypes?
    15·1 answer
  • What led to the understanding of complimentary base pairings in dna
    7·1 answer
  • The presence of the _________ suture distinguishes the muscoid flies from others, according to your reading.
    12·1 answer
  • 100 POINTS!!!!!!!!!!!!!!!! BRAINLIEST!!!!!!!!
    10·2 answers
  • Molecules that are not able to independently diffuse across a membrane may still move down their concentration gradient by
    10·1 answer
  • What is one reason that there are very few errors in DNA replication?
    15·1 answer
  • Which of the following structures have a role in plant reproduction?
    12·2 answers
  • HELP HELP HELPPP
    8·1 answer
  • What provides an image that is three dimensional representation with little magnification
    7·1 answer
  • What is the symbol for chromate
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!