1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksanka [162]
3 years ago
5

GIVING AWAY 16 POINTS PLEASE HELP ME ASAP!!

Biology
2 answers:
Vedmedyk [2.9K]3 years ago
6 0

Answer:

i know C is one of them, if there are multiple i’m not sure what the others are

Explanation:

Anarel [89]3 years ago
4 0

Answer:

sorry can't see it clear

You might be interested in
A person’s will be the same on Jupiter and Earth. A person’s will be greater on Jupiter than on Earth.
koban [17]

Answer:

Greater on Jupiter

Explanation:

Gravity depends on mass. Jupiter has more mass than Earth so its gravity is two and a half times greater. Therefore a person will weigh more on Jupiter.

6 0
3 years ago
Read 2 more answers
Explain how he interaction between mRNA codons and tRNA codons anticodons codes for a specific amino acid
Julli [10]
<span>The interactions between the mRNA codons and the tRNA anticodons  codes for a specific amino acid is by, it is the job of the tRNA to start working after the mRNA has able to have its own complementary copy. The mRNA will undergo to the nucleus and will move out, in order to go the rrna. The three nucleotides codes the specific amino acid of the trna. The trna and the mrna will be matched, it will now release the amino acid in the trna that wil form a peptide bond. When the mrna is able to be decoded to form an amino acid, it will now have the ability to break and make proteins in different structures.</span>
5 0
3 years ago
What does archaeocetes literally mean ?
anygoal [31]

Answer:

ancient whales

Explanation:

3 0
3 years ago
Read 2 more answers
In the past, human populations were controlled by:
Scorpion4ik [409]
<span>In the past, human populations were controlled by </span>Disease and Famine
4 0
3 years ago
plants contain xylem and phloem tissue. what organ system in animals performs a similar function as the xylem and phloem of plan
Basile [38]
In animals, the circulatory system performs a similar function because it transports vital nutrients around the body of the animal, just like how xylem and phloem transport water, minerals, and sugar to different parts of the plant.
5 0
3 years ago
Read 2 more answers
Other questions:
  • atmospheric pressure begins to fall slowly during the afternoon on a clear summer day. the pressure continues to drop overnight.
    10·1 answer
  • How is the circulatory system related to the digestive system??
    12·1 answer
  • In meiosis, what makes up a tetrad
    12·2 answers
  • Small drops of precipitation are called what
    5·2 answers
  • Evolution at its base is about change. Change over time spans that humans can't even wrap their heads around. Just like a river
    8·1 answer
  • Which type of epithelium lines the inferior portions of the pharynx?
    5·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • How many miles does someone run in an 8km race?
    5·1 answer
  • What is the range of the pH scale
    15·2 answers
  • Which statement is not true about the Krebs Cycle?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!