1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
just olya [345]
3 years ago
11

Which represents the cross between two parent plants if one is heterozygous

Biology
1 answer:
Alinara [238K]3 years ago
8 0
Yy.yy is your answer ^-^
Hope am right. Good Luck!
You might be interested in
What is the best definition of Thebes term “theory”as it is used in science
marshall27 [118]

Answer: Definition

Explanation: In science, the word 'theory' refers to the way in which people interpret facts. A scientific theory is the framework for observations and facts. Theories may change, the way in which they are interpreted may change, but the facts remain the same.

6 0
3 years ago
When air gets warm does it sink or rise?
stiv31 [10]
Air rises when it is warmer
4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
On Earth is born Origins Nova
AURORKA [14]
Mars is just a fraction the size of the Earth, so it cooled more rapidly. And as it cooled, its molten iron core hardened. As a result, Mars stopped generating its magnetic shield. And, according to one theory, this left its atmosphere to be scoured away by the solar wind.
7 0
3 years ago
Student is comparing the cells of a prokaryote, an animal, and a plant.
Tomtit [17]

cell wall and chloroplasts

7 0
3 years ago
Other questions:
  • Inside the choloraplasts, chloropyll is found in the
    8·2 answers
  • After scientists collect data during a scientific experiment, what step do they usually take next
    5·2 answers
  • Un grupo de celula se llama organo<br>verdadero o falso?<br>​
    7·1 answer
  • Which would cause an electric circuit to lack a current?
    9·2 answers
  • The diagram below shows a simple version of the carbon cycle... How are the processes shown with yellow arrows different from th
    15·1 answer
  • The perimeter of a rectangle is 16 inches. The equation that represents the perimeter of the rectangle is 2 l plus 2 w equals 16
    15·1 answer
  • What happens during cellular respiration?
    10·1 answer
  • Small fish find shelter amongst the branching coral.
    10·1 answer
  • The __________ receives information from the visual and auditory senses. A. Forebrain B. Midbrain C. Hindbrain D. Brainstem Plea
    9·1 answer
  • Living organisms evolved in a world where they were constrained by the laws of physics and chemistry. Describe the two laws of t
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!