Answer:
50% slipper footed, 50% non-slipper footed
Answers:
A. 50-70% - neutrophils
B. 20-40% - Lymphocytes
C. 2-8% - monocytes
D. 1-4% - eosinophils
E. < 1% - basophils
Explanation:
The blood differential test is used to estimate the percentage of each class of white blood cell (WBC) present in the blood and to indicate the presence of abnormal or immature cells.
The Test is Performed by taking of blood sample which is smeared onto a glass slide, then it's stained with a unique dye to indicate the class of white blood cells.
The Five class of white blood cells are
Neutrophils
Lymphocytes (B cells and T cells)
Monocytes
Eosinophils
Basophils
The different class of white blood cells are given as a percentage:
Neutrophils: 40% to 60%
Lymphocytes: 20% to 40%
Monocytes: 2% to 8%
Eosinophils: 1% to 4%
Basophils: 0.5% to 1%
Band (young neutrophil): 0% to 3%
Answer:
Mitosis, Meiosis, and both are written below
Explanation:
Mitosis: produces more somatic (body) cells, purpose is for healing and growing, the daughter cells are exact replicas
- This is because mitosis occurs in body cells and is used for growth, so all the daughter cells are the same.
Meiosis: results in sex cells (gametes), results in eggs and sperm, purpose is for creating new individuals (eventually), each daughter cell is different, has 2 separate division stages
- This is because meiosis occurs in gametes and is used in reproduction.
Both: Chromosomes need to replicate before the whole process begins, a form of reproduction
- This is because both are reproducing (they are dividing) and DNA must be replicated so each daughter cell has it.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Answer:
yes
Explanation:
Another fact is that the Banana plant is one of those perennial plants whose parts can be used as food, starting from its fruits-the bananas to its roots tubers. Banana tubers have been used as food mostly in states like Uganda, Indonesia, and also India.
