1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
love history [14]
3 years ago
8

Suggest me best subject for invertibrate for presentation​

Biology
1 answer:
uysha [10]3 years ago
7 0

Answer:

Subject : jellyfish or any othet sea animal

You might be interested in
A food contains 28 g carbohydrates 2.7 G protein and 0.3 fats
d1i1m1o1n [39]
I hope this help, answer is 125.5kcal‍♀️
7 0
3 years ago
What is the correct term for anthropology’s commitment to studying the entire picture of human life, including culture, biology,
jekas [21]

Holism.

Explanation:

Anthropology is the branch of scientific studies that deals with study of human development in terms of body structure, culture,social behavior and language.

Biological anthropology deals with the evolution of man on the basis of biological structures.

Cultural anthropology deals with the evolution of different culture and society.

Social anthropology deals with the evolution of various societies from the time when man was totally uncivilized.

Linguistic anthropology  deals with the study of evolution of languages.

In short anthropology deals with all the aspects of human beings. This commitment of anthropology to studying the entire picture of human life,including culture,biology,history and language is termed as Holism.

6 0
3 years ago
A forest fire lightly burned part of the park. The fire added nutrients to the soil. The fire also helped pine cones open and dr
sdas [7]
It is defiantly not a, because only part of the park was burnt. It wouldn't be c, because fire does not cause seeds to fly in. I would say B
8 0
3 years ago
Read 2 more answers
Write the main strategy to prevent flood<br><br>Help please ​
Anna007 [38]

Answer:

Flood barriers are very affordable, lightweight metal barriers may be installed in different places and taken away when water disappears.

Explanation:

6 0
3 years ago
Which distinguish structures of a eukaryitic cell are part of the internal membrane system
Nitella [24]

The answer in order is

Vesicle, Golgi Apparatus, Endoplasmic Reticulum, and Nuclear Membrane

Hope this helped!!

7 0
3 years ago
Read 2 more answers
Other questions:
  • There are five basic types of emergencies that every hunter should know about. which emergency is listed here?
    5·2 answers
  • What problems could arise in the circulatory system from poor nutrition and lack of exercise?
    11·1 answer
  • Help plzzzzzzz BIOLOGY
    8·2 answers
  • What are the similarities and differences between the water and carbon cycles?
    5·1 answer
  • Consider the diagram that depicts the lysogenic and lytic cycles.
    9·1 answer
  • The information that calls for a specific amino acid is found in the?
    14·1 answer
  • Which of the following would not be considered a nontraditional sport
    14·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Explain how the use of poisons to combat pests has led to resistance in pest populations such as rats
    6·1 answer
  • Name and/or describe as many human body systems as you can. what is the function of each body system and what are some of the ma
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!