1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ella [17]
3 years ago
8

Some students correctly made a life cycle model for two specific animals. One group has made a model

Biology
1 answer:
just olya [345]3 years ago
7 0

Answer:

Option C

Explanation:

You might be interested in
A population of rabbits contains some rabbits that are brown, grey, and white. The habitat of the rabbits historically was a col
Elena-2011 [213]

b is the right answer I think


if you or anyone you know is good at math then please go to my profile and check out my question that I need answered

3 0
3 years ago
In Part I, the independent variable, the one that is intentionally manipulated, is
chubhunter [2.5K]

Answer: i'm confused is this the right assignment?

Explanation:

3 0
3 years ago
The name of the blood cell that destroyed cells
irina [24]

<u>T cells lymphocytes </u>are a type of white blood cell that actively target and destroy infected cells via the production of antibodies.

6 0
3 years ago
Read 2 more answers
Which of the following are believed to have a role in aging and cancer
kicyunya [14]
I think that not being active can mess with this
3 0
3 years ago
A característica que comprova o fato de o texto apresentado não ser um lide, mas uma chamada é
Brums [2.3K]

Answer:

c. o resumo do jornal com as principais noticias do dia.

Explanation:

O resurso que comprova que o texto apresentado no jornal nao e um lead e a principal noticia do dia. Isso e cosiderado uma chamada.

6 0
4 years ago
Other questions:
  • A plant with the dominant trait, wrinkled seeds, is crossed with a plant that has non-wrinkled seeds. All of the offspring are a
    12·2 answers
  • Suppose that an unusually high degree of aurora kinase activity is observed in the cervix. What could we reasonably conclude abo
    8·1 answer
  • Test your knowledge about eukaryotes by sorting the following statements according to whether they’re true or false
    13·2 answers
  • Lauren is a senior at a nearby high school. She is a good student who does her work on weekdays and likes to party on the weeken
    5·1 answer
  • The main reason that cells carry out cellular respiration is to _______
    7·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What is one function of steroids?
    12·2 answers
  • The graph shows how much a plant grew over a five week time period. According to the graph how many centimeters did the plant gr
    12·2 answers
  • Can someone help me find the words? <br><br>Word search only answer if you an expert at it PLEASE
    12·1 answer
  • Streak<br> This decision making value has to do with the gain or loss of money or jobs
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!