1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inysia [295]
3 years ago
8

What is created when chemical reactions join atoms together?

Biology
2 answers:
Anna35 [415]3 years ago
7 0
Reactions and compounds. New substances are formed bychemical reactions. When elements react together to form compounds their atoms join to other atoms using chemical bonds. For example, iron and sulfur react together to form a compound called iron sulfide.
IceJOKER [234]3 years ago
4 0
Reactions and/or Compounds 
You might be interested in
Which of the following best describes passive immunity?
sweet-ann [11.9K]
All of about is the answer
7 0
3 years ago
Budding and sporularion are forms of reproduction. A) asexual B) binaey C) artifical D) sexual
True [87]
This is asexual reproduction 
5 0
3 years ago
Read 2 more answers
If a period contains many fossils of species that previously weren't found, what type of event most likely took place on Earth?
Ira Lisetskai [31]

Answer:D

Explanation:

7 0
3 years ago
In the reaction 3H2 + Blank Space __________N2 → 2 NH3, what coefficient should be placed in front of N2 to balance the reaction
Helga [31]
Count the number of same elements before and after →
Make sure number of same elements on both sides are equal
2N on the right side, so it is 1N2
4 0
3 years ago
Read 2 more answers
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Other questions:
  • What is likely to happen to a healthy population that is experiencing exponential growth?
    14·2 answers
  • Biology 2, Help Please.
    8·2 answers
  • Please help me with my biology.. ​
    10·1 answer
  • What does the word "cycle" tell you about the chemical reactions of the Calvin cycle?
    15·1 answer
  • You observe a plant on your windowsill that is growing at an angle toward the outside. This is an example of a living thing ____
    10·1 answer
  • The science of heredity
    15·1 answer
  • Need help with this question ASAP:
    6·1 answer
  • In summary, transgenic _______________ flies will produce light in a pattern that reflects the _________________________________
    5·1 answer
  • Huntington Disease is an autosomal recessive condition. Which percentage
    11·1 answer
  • TRUE/FALSE. if one parent has all blue eyes in the family and the other parent has brown eyes can the baby have green eyes
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!