1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Jlenok [28]
3 years ago
10

Hurry! Worth 25 points, will get brianlest if correct! Which processes result in genetic differences between parents and offspri

ng and among offspring? Check all that
apply

the crossing over of paired chromosomes

the independent assortment of genes

the replication of DNA before a cell divides

the separation of chromosomes to opposite sides of the cell

the condensing of DNA into a chromosome
Biology
2 answers:
vredina [299]3 years ago
8 0

Answer:the  independent assortment of genes.

the separation of chromosomes to opposite sides of the cell

Have a good day

Explanation:

Sergeeva-Olga [200]3 years ago
5 0

Answer:

a and b :)

Explanation:

You might be interested in
Which factors are responsible for high and low tides?
Vaselesa [24]
The following diagram shows how the moon causes tides on Earth: In this diagram, you can see that the moon's gravitational force pulls on water in the oceans so that there are "bulges" in the ocean on both sides of the planet. The moon pulls water toward it, and this causes the bulge toward the moon.
6 0
3 years ago
A) ¿Qué son las enzimas y por qué se las denomina catalizadores biológicos?
Setler [38]

Answer:

las enzimas son proteínas y aceleran reacciones químicas.

8 0
2 years ago
Yeast is used in making bread. Explain why?
Margarita [4]

Explanation:

<h2>Yeast is used for the leavening of bread. Yeast uses the sugars and oxygen in dough to produce more yeast cells and carbon dioxide gas. This is called multiplication. The carbon dioxide makes the dough rise which gives the bread a light and spongy texture.</h2>
6 0
3 years ago
Which is not a factor used to divide the ocean into distinct marine life zones?
nignag [31]
Latitude is not a factor in marine life divisions.
5 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • Primary producers transform energy from sunlight and certain inorganic chemicals into ________.
    15·1 answer
  • Which phrase best defines erosion? A. layering bits of rocks and soil B. cementing layers of rock together to form stone C. brea
    7·2 answers
  • A skull from the genus Homo that dates from approximately 750,000 years ago is discovered. Where is the foramen magnum be locate
    9·1 answer
  • Where is the electron transport chain for cellular respiration located?
    9·1 answer
  • A government website?, reliable or unreliable
    5·2 answers
  • You and your colleagues are constructing a pedigree for a boy with cystic fibrosis. The individual’s younger brother has also be
    6·1 answer
  • Identify the purpose of a reference point
    6·2 answers
  • Which macromolecule is needed for lactic acid formation and alcohol fermentation to proceed with their processes?
    15·1 answer
  • Fungi, many birds, and a wide variety of insects all share the what of a tree in the forest.
    5·2 answers
  • 2. Мынадай: «метр», «сантиметр», «миллиметр», «микрометр», «мик-
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!