Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
The biological carbon cycle is not only faster than the geological carbon cycle. The amount of carbon taken up by photosynthesis and released back to the atmosphere by respiration each year is 1,000 times greater than the amount of carbon that moves through the geological cycle on an annual basis.
Explanation:
The Gibraltar rock is a limestone, therefore it is a sedimentary rock. Sedimentary rocks are made by the dethronement and squeezing of small fragments.dimentary rock. It has sediments.
Different stars are different colors depending on the temperature. So, for example, a blue star is hotter than a yellow star such as our Sun.
