1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WARRIOR [948]
3 years ago
15

Some cells live for years, while others live for only a few days. Why do some cells get replaced faster than others?

Biology
1 answer:
Vladimir [108]3 years ago
7 0

Answer:

<em>Some </em><em>cell</em><em>s</em><em> </em><em>don't </em><em>divide </em><em>and </em><em>last </em><em>you </em><em>a </em><em>life </em><em>time </em><em>such </em><em>as </em><em>many </em><em>of </em><em>those </em><em>in </em><em>the </em><em>central </em><em> </em><em>nervous</em><em> </em><em>system </em><em>other </em><em>c</em><em>ells </em><em>such </em><em>as </em><em>stems </em><em>called </em><em>cell </em><em>population</em><em>s</em><em> </em><em>have </em><em>their </em><em>telemeres </em><em>repeatedly</em><em> </em><em>exten</em><em>d</em><em>ed </em><em>by </em><em>the </em><em>enzyme </em><em>telomerase </em><em>other </em><em>cells </em><em>are </em><em>never </em><em>repla</em><em>c</em><em>ed </em><em>and </em><em>live </em><em>as </em><em>long </em><em>as </em><em>we </em><em>do </em><em>.</em>

<em><u>I </u></em><em><u>hope this </u></em><em><u>answer </u></em><em><u>might </u></em><em><u>help</u></em><em><u> </u></em><em><u>u </u></em>

You might be interested in
Will give brainliest to first correct answer.<br><br> Explain how the superbug was created.
jolli1 [7]

Answer:

A superbug refers to a germ that has formed resistance to multiple drugs that once treated the infection caused by the germ. The term “superbug” was developed by the media. While any germ may become a superbug, bacterial and fungal strains that routinely infect humans, animals, and crops are most likely to do so.

Superbugs are strains of bacteria that are resistant to several types of antibiotics. ... And the overuse and misuse of antibiotics helps to create drug-resistant bacteria. Here's how that might happen. When used properly, antibiotics can help destroy disease-causing bacteria.

8 0
3 years ago
Enzymes tend to not work in extremely hot temperature because?
xxMikexx [17]

Answer:

C

Explanation:

5 0
3 years ago
According to the Endosymbiotic Theory, infoldings in the cell membrane of an ancestral prokaryotic cell gave rise to endomembran
Ad libitum [116K]

Explanation:

<u>False:</u> C) The ER provides separate microenvironments for each of the modifications that must take place to proteins.

The golgi apparatus comprised of several components called cisternae, these function as different microenvironments, where further modification proteins and lipids into functional biomolecules occurs.

During protein synthesis, transcription occurs in the nucleus, followed by translation within ribosomes, the newly synthesized proteins enter endoplasmic reticulum where they undergo folding and modification. Within the golgi body, the proteins are tagged and parceled into lysosomes for export.

Further Explanation:

The endoplasmic reticulum is a membrane system within the cytoplasm that extends from the outer nuclear membrane. Apart from increasing the surface area within the cell, this continuous system also carries out protein folding, synthesis and transport. In the endoplasmic reticulum or ER, some sections called the smooth ER, do not contain ribosomes, and may contain lipids, enzymes, and other proteins. Other sections bound to ribosomes, are called the rough Er. As a protein destined for the endomembrane system is being synthesized by a ribosome, the first amino acids in the growing polypeptide chain act as a signal sequence. That signal sequence ensures that the ribosome binds to the outer membrane of the ER and that the protein enters the ER lumen. The proteins undergo major modifications and are packed into vesicles.

Golgi bodies are flat, disk-like membranous regions. Proteins traverse the organelle by first having their vesicles bind to the cis face or receiving end. Like a post office, the golgi complex, or golgi body recognizes specific signal sequences, targets and further modifies and packages these compounds into lysosomes for delivery to their final destination.  Proteins here undergo peptide processing and glycosylation

Learn more about cellular life at brainly.com/question/11259903

Learn more about mitochondria and similar structures at brainly.com/question/2855039

#LearnWithBrainly

7 0
3 years ago
Which excerpt uses actions to develop Marlene's character? A. "I wish my parents were more like Kat's," Marlene confessed. "They
Harman [31]

Answer: We can ignore both A and B as they are not actions at all

And C is ruled out because it isn't Marlene's action it's Tami's therefore the answer is D. D also develops Marlene's character as it shows her anxiety and her caring nature towards her cat.

Hope this helps, and please mark me brainliest! >//<

4 0
2 years ago
Giving almost 20 pionts!!!!HELP!!!
Leokris [45]
Protists<span> are a heterogeneous group of living things, comprising those eukaryotes that are neither animals, plants, nor fungi. </span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • 3. Which plant organelle carries out photosynthesis and produces the gas?
    10·1 answer
  • What is not a characteristic of life
    8·1 answer
  • Consider a cross to investigate the pea pod texture trait, involving constricted or inflated pods. Mendel found that the traits
    12·1 answer
  • What type of wave is sound?
    14·1 answer
  • An amino acid mixture consisting of alanine, phenylalanine, and lysine is to be separated by normal phase HPLC. The stationary p
    12·1 answer
  • Please help me with these ones ill mark u as the best answer if correct
    13·1 answer
  • Which of the following is a function of the nucleus?
    13·2 answers
  • Can someone plz help me? ;(
    11·2 answers
  • Which nutrient do adolescent females need less of than adolescent males?.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!