Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer: The energy comes from the sun.
Explanation:
Answer:
Within the geological structure of Cayuga Lake Basin there is a diversity of limestone sources, which would make it possible for the lake to be a good location for the construction of a cement-making plant.
Explanation:
Cayuga Lake, part of the so-called Finger Lakes, located in New York, has an extension of about 40 miles. This lake is of great economic and ecological importance, because it allows fishing and recreation activities, besides being a place of passage for migratory birds.
The Skaneateles, Onandaga, Marcellus, Manilius, Moscow and Tully formations are an important source of limestone of variable quality, from which lime can be obtained for the manufacture of cement.
Although the presence of limestone would be ideal for building a cement-making plant, a project of this size should consider the environmental impact it could have.
Learn more:
brainly.com/question/13764464
Answer:
Explanation:
Alanine is the correct answer
