1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ale4655 [162]
3 years ago
11

Which description properly describes a step involved in cellular respiration? Glucose is broken apart, then the energy gained is

transferred to the energy molecule. Carbon dioxide is combined with oxygen to make glucose. Water is divided into carbon dioxide and glucose. Oxygen is combined with the energy molecule to energize it.
Biology
2 answers:
nydimaria [60]3 years ago
8 0
glucose is broken apart then the energy..... This is correct
I used A and got it right..
hope this helped
GREYUIT [131]3 years ago
3 0

Answer: Glucose is broken apart, then the energy gained is transferred to the energy molecule.

Respiration is a metabolic process that occurs in all living organisms. In humans the energy is produced in the human body by respiration, when a single molecule of glucose is broken down into six carbon dioxide and six water molecules in the presence of oxygen. The energy produced after this process is in the form of ATP (Adenosine triphosphate).  


You might be interested in
Organelles are...........?
Margaret [11]

Organelles(or-gahn-lś)

Specifically means little organ but is sometimes commonly used as the Rank below the tissue in the cell body..They live inside the cell taking care of most of our bigger organisms. :)

4 0
3 years ago
Read 2 more answers
What group of potential products must be tested in clinical trials before it can be marketed?
Hunter-Best [27]
<span>Any type of pharmaceutical product or dietary supplement must be tested in clinical trials before they can be marketed in order to assess their safety for the general public's consumption and to confirm their intended purpose. While not a complete fail safe, these tests intend to prove a reasonable sense of safety for the product.</span>
7 0
3 years ago
If a bowling ball hits a wall with a force of 6 N, the wall exerts a force of ____ back on the bowling ball. (1 point) 0 N 3 N 6
alexgriva [62]
The answer is 6 Newtons
7 0
3 years ago
During the Light dependent reaction of photosynthesis light energy is converted into which form of energy
Sever21 [200]
During the Light dependent reaction of photosynthesis light energy is converted into chemical energy
6 0
3 years ago
Read 2 more answers
Which is the best example of competition in a forest ecosystem?
Mrac [35]
D) Blue Jays and Finches nest in the same Oak Trees.

Explanation:

This is an example of competition because two species are for the same thing, in this case, oak trees to nest in.
3 0
3 years ago
Other questions:
  • In the fictional hobbit, there exist 5 alleles of the foot size gene:
    13·1 answer
  • Which type of front occurs when cold air and warm air are next to eachother, but are at a stand still?
    5·1 answer
  • Fish respiratory systems exchange gas and receive oxygen at the gills. This oxygen then enters the bloodstream and is pumped thr
    12·1 answer
  • 3. When a blood drop lands on a surface at a 90 degree angle, what shape is the drop in typically?
    14·2 answers
  • 3. Which is not an example of symbiosis?
    6·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What is the name of the process that stem cells undergo to become specialised cells?​
    5·1 answer
  • 1. change in the frequency of inherited traits in a population over generations.?
    7·1 answer
  • 27. What adaptation do organisms that live in an estuary have?
    15·2 answers
  • If a woman is a carrier for the color-blind recessive allele and her husband has normal vision. What are their chances that a so
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!