1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slava [35]
3 years ago
6

Fill in the Blank

Biology
2 answers:
irinina [24]3 years ago
7 0
Failed...
I’m not entirely sure
RUDIKE [14]3 years ago
4 0
Cheap, I’m pretty sure it’s right.
You might be interested in
What are some of the global health challenges that remain to be addressed?
erastovalidia [21]
Aids/ HIV
Cancer
The only thing that is a great weekend too many
6 0
3 years ago
What type of response involves an organism moving to or from the earth? Geotropism, internal response, phototropism fight or fli
tatyana61 [14]
The answer is, phototropism. phototropism is an organism that grows towards the sunlight away from earth.
8 0
3 years ago
Read 2 more answers
What products are made from the process of photosynthesis
MakcuM [25]

Answer: glucose and oxygen

Explanation:

The formula for photosynthesis is:

Carbon dioxide+water-->glucose+oxygen

Anything on the right of the arrow is the products so, it is glucose and oxygen.

Hope this helps :)

5 0
2 years ago
Read 2 more answers
Explain why an organism cannot choose to have a mutation that would enable it to live more successfully in its environment.
vaieri [72.5K]

Answer:

Explanation:

An organism can't chose to have a mutation because it depends on the way they are born. If they are missing some type of mineral, (Protein, Vitamin, etc.) they will have a mutation because they're missing that. Well, something similar to a mutation is natural selection and genes. For example, there are some short and tall giraffes. The tall ones can reach the tree and the short ones can't so they die and the tall ones can reproduce and their offspring will inherit that trait

6 0
3 years ago
WILL GIVE BRAINLIEST ANSWER AND THANK YOU!!!
zzz [600]
Incomplete please thank and mark brainliest

7 0
3 years ago
Other questions:
  • All living things can be found in the biosphere atmosphere hydrosphere geosphere
    7·1 answer
  • Jessica travels to a remote village in the Amazon jungle in order to work as a medical volunteer. While in this village, Jessica
    8·2 answers
  • Choose one Florida landform and explain how water erosion helped it form.
    8·1 answer
  • Which of these types of weathering does not require the presence of water?
    9·1 answer
  • Write the consenus sequence for the following nucleotide sequences AGGAGTT AGCTATT TGCAATA ACGAAAA TCCTAAT TGCAATT TGCAATT
    10·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • What do you know about Restriction Enzymes?
    14·1 answer
  • 1. Answer the following using complete sentences. a. Give an example of a situation or problem that would be difficult to test w
    13·1 answer
  • Rohanna and her cousin, Simarra, learnt about osmosis in school and planned to investigate the process for themselves. They boug
    8·1 answer
  • What is a mineral in the earth?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!