1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zanzabum
2 years ago
12

Porque los alimentos se oscurecen?(platanos, palta, manzana, papa, etc) respondan pls✋

Biology
1 answer:
inn [45]2 years ago
5 0

Answer:

Una enzima es una sustancia, generalmente una proteína, en la célula de un organismo que acelera las reacciones químicas.

Durante el pardeamiento enzimático, una enzima llamada fenolasa y otro compuesto orgánico que se encuentra en las células de la fruta llamados fenoles pasan por una reacción de oxidación cuando se exponen al oxígeno. La fenolasa regula la reacción, convirtiendo los fenoles en melanina.

Por lo general, las enzimas de la fruta están encerradas en tejido. Las enzimas están metidas en sus células, trabajando para madurar la fruta. Pero cuando esas células se descomponen, ya sea por una causa externa como si alguien muerde o corta la fruta o por causas naturales como el envejecimiento, las enzimas se liberan y entran en contacto con el oxígeno, lo que desencadena la reacción química y hace que la fruta se vuelva marrón.

You might be interested in
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
How to plants and animals get their energy in different ways?
andreyandreev [35.5K]
Plants get their energy from the sun using Photosynthesis and animals get it from eating food.
4 0
3 years ago
In hemoglobin, the transition from t state to r state (low to high affinity) is triggered by:_________
Elena L [17]

In hemoglobin, the transition from t state to r state (low to high affinity) is triggered by Bisphosphoglycerate (BPG)

  • Bisphosphoglycerate (BPG), also known as 2,3-Disphosphoglycerate (2,3-DPG), aids in the transition of hemoglobin from a high-oxygen-affinity to a low-oxygen-affinity state.
  • 2,3-BPG binds to hemoglobin, causing oxygen to be unloaded. Furthermore, 2,3-BPG reduces hemoglobin's affinity for oxygen. As hemoglobin is unloaded in our tissues, 2,3-BPG binds to it, promoting oxygen unloading.
  • When we increase the concentration of 2,3-BPG in our blood, the oxygen binding curve shifts to the right. This means hemoglobin will have a lower affinity for oxygen and will be able to deliver more oxygen to our body's tissues and cells.

Learn more about  Bisphosphoglycerate (BPG) from here:brainly.com/question/8885734

#SPJ4

4 0
1 year ago
How does temperature of water affect its ability to hold oxygen?
dalvyx [7]

Dissolved Oxygen and Water Temperature. The solubility of oxygen and other gases will decrease as temperature increases 9. This means that colder lakes and streams can hold more dissolved oxygen than warmer waters. If water is too warm, it will not hold enough oxygen for aquatic organisms to survive.

8 0
3 years ago
Which characteristic of life best describes the process of homostasis
Alex Ar [27]
Which Characteristic of life best describes the process of homostasis
4 0
3 years ago
Other questions:
  • A 33-year-old pregnant client asks the nurse about testing for birth defects that are safe for both her and her fetus. which tes
    6·1 answer
  • How is radioactive decay used to date sedimentary rocks?
    8·2 answers
  • If you place a probe in the aorta what chamber will it exit
    9·1 answer
  • What is the advantage of having Complexes I, III, and IV associated with one another in the form of a respirasome?
    5·1 answer
  • Micro: Step 1: Respond to the following:
    7·1 answer
  • Why does a butterfly look like the face of an owl?
    5·2 answers
  • Granite comes from the Latin word called <br>​
    6·1 answer
  • Are protons and neutrons the same?
    14·2 answers
  • What are the two types of energy sources??
    12·2 answers
  • Non example of a neutron
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!