1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksian1 [2.3K]
3 years ago
8

What is the origin of the word arthropod?

Biology
2 answers:
Kazeer [188]3 years ago
7 0

Answer:

Etymology

Explanation:

V125BC [204]3 years ago
7 0
Etymology. The word arthropod comes from the Greek ἄρθρον árthron, "joint", and πούς pous (gen. podos (ποδός)), i.e. "foot" or "leg", which together mean "jointed leg".
You might be interested in
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Which trait is determined by genetics alone ? Skin color athletic ability blood type big muscles
Likurg_2 [28]
Your blood type is genetic 
5 0
3 years ago
Read 2 more answers
What are the medical uses of hormones? ​
Natasha_Volkova [10]
The answer is:

Hormone therapy is used to treat cancers that use hormones to grow, such as some prostate and breast cancers. Hormone therapy is a cancer treatment that slows or stops the growth of cancer that uses hormones to grow. Hormone therapy is also called hormonal therapy, hormone treatment, or endocrine therapy
8 0
2 years ago
I need help please!!!
trasher [3.6K]

Answer:

B this is because it is specifically a man made lake with only catfish.

5 0
3 years ago
Both male and female gametes are created during the process of meiosis. The formation of male gametes or sperm is called spermat
Novay_Z [31]

Answer:

Both male and female gametes are created during the process of meiosis. The formation of male gametes or sperm is called spermatogenesis. After telophase II of spermatogenesis, there would be <u>four</u> male gametes created that are all genetically <u>haploid.</u>

Explanation:

Telophase II is the final step in Meiosis II. In Telophase II of the spermatogenesis chromosomes travels to opposite poles and are covered by a nuclear envelop.  The two parent cells result four daughter cells which are haploid (1n).  

3 0
3 years ago
Other questions:
  • A lung or swim bladder, which helps the body create a balance between sinking and floating by either filling up with or emitting
    14·1 answer
  • Help Please very quick! 40 points!
    15·1 answer
  • Which organelles surround the cell? Check all that apply.
    10·2 answers
  • Assuming that coleman???s hypotheses about the ob and db genes are correct, rank the mice by the amount of appetite-suppressing
    6·1 answer
  • Calcium chloride, a deliquescent salt, is used as a desiccant in laboratory desiccators to maintain a dry environment. Explain
    6·1 answer
  • 2. The lionfish are disrupting the marine food chain because there are no known predators. If you were a scientist working on th
    9·2 answers
  • Select the statements that are true for lactic acid fermentation carried out in muscle cells.
    14·1 answer
  • The name of an enzyme usually ends in
    5·1 answer
  • How did the occurrences of the different traits change over the 30-year period? Use evidence from the graph to support your answ
    12·2 answers
  • Grandma Rita fell down on the ice and landed on her hip. It knocked the head of the femur partially out of the joint capsule, wh
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!