Options are:
a) lymph.
b) interstitial fluid.
c) extracellular fluid (ECF).
d) plasma.
All the following are correct terms for this fluid except lymph.
The interstitial fluid surrounds the cells in the body. The other major component of the ECF is the intravascular fluid of the circulatory system called blood plasma. Whereas, Lymph is a fluid which contains infection-fighting white blood cells, throughout the body.
Nk cells
^_^
Hope these helps you
<span>C. metric ruler since millimeters are metric</span>
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
