1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
astraxan [27]
2 years ago
11

Which of the following moves using pseudopods ?

Biology
2 answers:
Alisiya [41]2 years ago
4 0
B is the correct answer in this problem
marissa [1.9K]2 years ago
3 0

Answer:

B

Explanation:

You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
What process takes place at the boundary between the capillaries and the alveoli?
Schach [20]

Answer:

Carbon dioxide enters the alveoli, and oxygen enters the capillaries.

Explanation:

This describes the exchange of gases in the lungs. When blood from the rest of the body gets to the lungs through the capillaries, oxygen flows from the alveoli which are tiny air sacs in the lungs, into the blood in the capillaries.

Carbon dioxide from the blood brought to the lungs will then flow into the alveoli which will then expel it through the nose. This repeated process ensures that the body keeps getting oxygen and expelling carbon dioxide.

5 0
2 years ago
.
horsena [70]

Answer:

C is correct ans

Explanation:

Mark my answer as brainliest and thank me

5 0
3 years ago
What is the probability that the couple would have
loris [4]
Go to the Prenatal Testing page for more details. If one parent has sickle cell trait (HbAS) and the other has sickle cell anaemia (HbSS) there is a one in two(50%) chance that any given child will get sickle cell trait and a one in two chance that any given child will get sickle cell anaemia.
5 0
2 years ago
If a parent cell has 54 chromosomes how many will the daughter cell have after meiosis
melamori03 [73]
54÷2=27 chromosomes .
8 0
3 years ago
Other questions:
  • Moves water from cell to cell without tubes<br> A.) vascular <br> B.) nonvascular
    12·1 answer
  • in humans, having freckles is dominant over not having freckles. A heterozygous male with freckles has children with a female wh
    7·1 answer
  • Which label correctly identifies what x represents in the concept map?
    5·1 answer
  • Define heredity its meaning
    15·1 answer
  • An _____ is used to measure amounts of isotopes in samples.
    12·1 answer
  • The pancreas secretes the hormones insulin and glucagon for homeostatic control of ______ levels in the blood. A. Glucose B. Sod
    13·1 answer
  • Higher frequency means what about the energy of the wave? * 1 point
    15·1 answer
  • Which human traits form a wide range of states instead of two distinct states
    13·1 answer
  • With a population in Hardy-Weinberg equilibrium, the A allele has a frequency of 0.60, and the frequency of the a allele is 0.40
    11·1 answer
  • What are the two types of hypotheses used in a hypothesis​ test? how are they​ related?.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!