1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PtichkaEL [24]
3 years ago
9

Explain what "aquifer" means

Biology
2 answers:
EleoNora [17]3 years ago
7 0

Answer/Explanation:

An aquifer is an underground layer of permeable rock, sediment (usually sand or gravel), or soil that yields water. The pore spaces in aquifers are filled with water and are interconnected. This causes it to transmits water to wells, springs, etc.

allochka39001 [22]3 years ago
6 0

Answer: An aquifer is a body of rock and/or sediment that holds groundwater.

Explanation:

You might be interested in
Which of the following is not a lifestyle risk factor for cardiovascular disease?
san4es73 [151]

Answer:

A I'm pretty sure cause t hff sts really the only one that makes sense

6 0
3 years ago
Read 2 more answers
1.Identify three organelles found in plant cells that are NOT found in animal cells.
zubka84 [21]

Answer:

2. plant cell has more defined shape than the shape of an animal cell, because the plant cell has a cell wall that gives it a rigid shape

6 0
2 years ago
In the experiment, which of the following variables should remain consistent?
photoshop1234 [79]

All of the above is correct

7 0
3 years ago
Consider a species of field mouse that lives in a region divided by a large, impassable river. One population of mice lives on o
kondor19780726 [428]

Answer:

The mice population do not involve in the same line.

Explanation:

The gene flow refers to the transfer of the gene from one population to another population and natural selection is the mechanism in which the survival rate and reproduction of the population are decided by the nature following the rule of the survival of the fittest.

In the given question, the mice population got separated due to the river which acted as a barrier between the mice population. The presence of this barrier reduces the chances of the gene flow between them as it is impossible for the mice population to cross the river.

As a result of this, the mice population will start surviving in different regions on both the sides of the river where it is not necessary that the same environmental pressure will act on the population of the mice.

Thus, the mice population do not evolve in the same line.

4 0
3 years ago
Photosynthesis is a step in the global nitrogen cycle <br> a. True <br> b. False
DanielleElmas [232]
This is false. Photosynthesis is a plant cycle. Hope this helps!! :)

8 0
3 years ago
Other questions:
  • What is the agent of weathering?
    15·2 answers
  • The pairing of chromosomes and the exchange of DNA between chromosomes is called crossing over, the diagram below illustrates th
    5·2 answers
  • 13. A biochemist isolated and purified molecules needed for replication. When DNA was added, replication occurred but the DNA mo
    15·1 answer
  • Explain how DNA is vital to understanding evolution.
    10·2 answers
  • When is the net movement of water equal to zero?
    15·1 answer
  • Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
    5·1 answer
  • WILL GIVE BRAINLIEST!!!!!
    5·1 answer
  • What is volume?
    14·2 answers
  • 5. Should the power plant be built here? Why or why not? Use facts from the assignment and your research to support your answer.
    10·1 answer
  • How would a drought in Arizona most likely affect the population density of the Mexican wolf population?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!