1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
loris [4]
3 years ago
11

Several things put together are called

Biology
1 answer:
IrinaK [193]3 years ago
8 0
A sedimentary rock is bits of broken up rock
You might be interested in
Which is a reason why wetlands are important?
torisob [31]

Answer:

They are estuaries

Explanation:

5 0
3 years ago
Read 2 more answers
Transcribe the following gene into mRNA.
Reil [10]

Answer: A T G C G C A T T A G T G C A G G A C A G T A G

Explanation:

3 0
3 years ago
Soil formation is most influenced by<br> Climate<br> Plants<br> Wind<br> Animals
german
Soil formation is most influenced by climate
8 0
3 years ago
Which of the following types of land is the richest in nutrients and organic material
marta [7]

Answer:

Fertile soils teem with life. Porous loamy soils are the richest of all, laced with organic matter which retains water and provides the nutrients needed by crops. Sand and clay soils tend to have less organic matter and have drainage problems: sand is very porous and clay is impermeable.

4 0
3 years ago
Read 2 more answers
Helppp Pleaseee Ill give u pointssss
Ksenya-84 [330]

Answer:

I think it is F.

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which rock feature is the line running between points A and B most likely to be?
    15·1 answer
  • Why is it cooler in mountains than at nearby places located at lower elevations?
    15·2 answers
  • What treats the body using principles similar to acupuncture and acupressure?
    13·1 answer
  • True or false more objects cab be dissolved into water than sulfuric acid
    13·2 answers
  • Below are listed pairs of anatomical structures. The first is a layer of the wall of the eye, and the second is a structure that
    11·1 answer
  • In repeating the investigation, the student accidentally drops and steps on the lead ball. This action changes its shape from a
    8·1 answer
  • Alexis, a middle-aged woman, is very moody and becomes irritable at the slightest provocation. Recently, her waist size has incr
    8·1 answer
  • Sexual reproduces offspring that are genetically ___ to the parent.
    12·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • What are the light gray lines in the graph showing? Provide EXAMPLES
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!