Forest fires promote regrowth, clear cut has to be replaced
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
The correct answer is: 2.5%
The vast majority of the human genome (97.5%) is comprised of non-coding DNA with different functions. Non-coding DNA includes telomeres, introns, non-coding RNA genes and gene regulatory sequences.
• Telomeres-ends of DNA with protective role (prevents shortening of DNA),
• Non-coding RNA genes-e.g. genes for tRNA,
• Gene regulatory sequences such as promoter, enhancers and silencers.
The correct description is:
Aristotle’s and Linnaeus’s classification systems both divided all life into two groups: plant and animal: option B.
<h3 /><h3>What was the work of Aristotle and Linnaeus centered on?</h3>
Aristotle was a Greek philosopher who studied life and living things to be able to explain their behavior.
Linnaeus was a Biologist who studied and classified living things into plants and animals.
Aristotle and Linnaeus both classified living things into plants and animals.
Learn more about classification of living things at: brainly.com/question/1196356
#SPJ1
