1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrezito [222]
3 years ago
6

Please explain how to do this

Mathematics
1 answer:
Helen [10]3 years ago
8 0

9514 1404 393

Answer:

  1/2

Step-by-step explanation:

The rules of exponents are helpful.

  (a^b)^c = a^(bc)

  a^-b = 1/a^b

__

  25^{\frac{1}{2}}\times10^{-1}=\dfrac{(5^2)^{\frac{1}{2}}}{10^1}=\dfrac{5^{2\cdot\frac{1}{2}}}{10}\\\\=\dfrac{5^1}{10}=\dfrac{5}{10}=\boxed{\dfrac{1}{2}}

You might be interested in
the food bill for meal at a restaurant is $12. THe sales tax is 6.5%, and you leave 15% tip. Wat is the total cost of the meal?
jeka57 [31]

Answer:

Step-by-step explanation:

12*6.5%=0.72

12+15%=13.8

0.72+13.8=14.52

6 0
2 years ago
Simplify and solve for the unknown. Use order of operations as needed.<br>8×2+5^2-y=2(y+1)+6 ​
Ket [755]

Answer:

y = 11

Step-by-step explanation:

8 × 2 + 5²- y = 2(y + 1) + 6 ​

8 × 2 + 5²- y = 2y + 2 + 6 ​

8 × 2 + 25 - y = 2y + 2 + 6 ​

16 + 25 - y = 2y + 2 + 6

41 - y = 2y + 8

41 (- y + y) = (2y + y) + 8

41 = 3y + 8

41 - 8 = 3y (+ 8 - 8)

33 = 3y

33/3 = 3y/3

y = 11

3 0
3 years ago
Which of the following is the graph of f(x) = -0.5|x+3| -2?
Tcecarenko [31]

Answer:

The last graph

Step-by-step explanation:

We transform functions in the following ways:

  • multiplying the function by a number to stretch or shrink it
  • multiplying by a negative to flip the orientation of the function
  • adding/subtracting a value to the input x to shift it horizontally
  • adding/subtracting a value to the output (or outside the function operation) to shift it vertically or horizontally.

Looking at the equation we can see f(x)=-0.5\left|x+3\right|-2

  • Vertically shrunk by 0.5
  • Negative leading coefficient to flip the graph's orientation
  • Horizontal shift of the vertex of 3 units to the left from (0,-2) to (-3,-2)
  • Vertical shift of the vertex of 2 units downward (-3,0) to (-3,-2)

The last graph has vertex (-3,-2) and satisfies the the equation.

7 0
3 years ago
Read 2 more answers
What’s the correct answer for this?
Nataliya [291]
An independent event is an event in which the outcome isn't affected by another event. A dependent event is affected by the outcome of a second event.
7 0
3 years ago
Y +3=2<br> What is m and b
ELEN [110]
I think it’s -1 not sure
6 0
3 years ago
Read 2 more answers
Other questions:
  • in a rock concert ,2/7 of spectators purchased 1000rs tickets while remaining 15000 purchased 500rs tickets. how many spectators
    12·2 answers
  • How far will a jet travel in 2 hours and 30 minutes if its average speed is 450 miles per hour?
    14·2 answers
  • Graph the system of inequalities. Then use your graph to identify the point that represents a solution to the system.
    15·1 answer
  • Josephine has a rectangular garden with an area of 2x2 + x – 6 square feet
    5·2 answers
  • Temperatures in °F can be converted in °C
    10·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • What is the product?
    8·2 answers
  • 3kg a hit with a force of 9 Newton’s
    9·1 answer
  • A wheel of radius 10 inches is rotating 20°/sec. What is the linear speed in in/sec and the angular speed in RPM? (Round your an
    11·1 answer
  • Gemoetry <br> PLEASE HELP!!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!