1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ICE Princess25 [194]
3 years ago
13

The expression “like a ton of bricks” means “very hard.” Would being hit by an actual ton of bricks hurt if it happened on the m

oon?(1 point)
No, it would not hurt as much because the bricks would have less mass.

Yes, it would hurt because the bricks would still have the same mass.

No, it would not hurt as much because the bricks would have less weight.

Yes, it would hurt because the bricks would still have the same weight.
Biology
1 answer:
Marat540 [252]3 years ago
4 0

Answer:

No, it would not hurt as much because the bricks would have less mass.

Explanation:

also can you answer my question I just posted. its worth 50 points, i need help.

like "oga for oga" just not "eye for eye" its "answer for answer"?

You might be interested in
What reaction is exothermic?
GenaCL600 [577]
An exothermic reaction<span> is a chemical </span>reaction<span> that releases energy by light or heat. It is the opposite of an </span>endothermic reaction<span>. Expressed in a chemical equation: reactants → products + energy.</span>
6 0
3 years ago
Read 2 more answers
Which term describes an area where sugars are used or stored?
Margarita [4]
<span>Sink 

A sink is an area where sugars are used or stored; typically, these are the roots and fruits of a plant.</span>
5 0
3 years ago
Asap.....Explain how observations are used to form hypotheses​
Amiraneli [1.4K]

Explanation:

Observations allow us to collect data that we can connect back to the central problem. From this data we can start to form hypotheses (predictions on possible solutions or outcomes).

6 0
1 year ago
Once nutrients have been broken down through the process of cellular respiration, which of the following must also happen in ord
vladimir1956 [14]

Answer:

A.

Explanation:

8 0
3 years ago
Read 2 more answers
If each bacterium is a copy of the last, how do the bacteria adapt to the presence of the antibiotic
pav-90 [236]
By mutating, especially if it is RNA stranded it will mutate quicker than DNA. Hope this helps brainliest would be awesome!
8 0
3 years ago
Other questions:
  • Which statement below is most accurate about the processes of mitosis and meiosis?
    13·2 answers
  • Earth is a system compromised of interacting processes<br> T or f
    6·2 answers
  • Fill in the blank with the appropriate term. 1.The___________ is often considered to be the cell's control center. 2.The________
    7·2 answers
  • What kind of cells can you find in mitochondrial in
    8·1 answer
  • What limits most cells to a very small size?
    5·1 answer
  • Base your answer to the question on the information below and on your knowledge of biology. There are two different species of f
    14·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • 6. ¿Cuál de las siguientes moléculas está formada por
    8·1 answer
  • What are the metric units for acceleration?
    7·1 answer
  • What might happen to renewable resource like trees if we use them?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!