1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blagie [28]
3 years ago
12

Define Trait please

Biology
2 answers:
Tju [1.3M]3 years ago
8 0
Trait is an obvious, observable, and measurable trait; it is the expression of genes in an observable way. An example of a phenotypic trait is a specific hair color
balu736 [363]3 years ago
3 0

Answer:

a distinguishing quality or characteristic, typically one belonging to a person.

Explanation:

A trait is a distinguishing feature of a person's character. It can be physical or behavioral. An example of a behavioral trait is the tendency politicians have to exaggerate. An example of a physical trait is having blond hair and blue eyes.

hope this helps...

..... (¯`v´¯)♥

.......•.¸.•´

....¸.•´

... (

☻/

/▌♥♥

/ \ ♥♥

You might be interested in
Compare and contrast relationships between organisms such as mutualism, predation, competition and commensalism
kompoz [17]
Hello

compare<span> and/or </span>contrast relationships between organisms<span>, </span>such as mutualism<span>, </span>predation<span>, parasitism, </span>competition, and commensalism<span>. Students will describe and/or explain the roles </span>of<span> and </span>relationships among<span> producers, consumers, and decomposers in the process </span>of<span> energy transfer in a food web.
</span>
Have a nice day
5 0
3 years ago
Blood pressure is the pressure exerted by blood against......
mart [117]

Answer: B artery wall

5 0
3 years ago
How does a human end up with an extra chromosome?
Burka [1]

Answer:

It’s a change in gentic cells, or are missing extra chromosomes

Explanation:

8 0
3 years ago
other than earth, is also known to have magnetic pole reversal? A:venus B:Mars C:Earths moon D: The Sun
Dafna1 [17]

Answer:

c.earths moon

Explanation:

earths moon rotates around the earth and causes night to the earth ,as we all know,so c. is the answer.

8 0
3 years ago
Read 2 more answers
[O.05]Read the paragraph below.
liubo4ka [24]

Answer: geosphere and biosphere

Explanation:

The geosphere is the part of the earth which lies below the earth crust. The biosphere is the sphere where all living beings survive.

According to the given situation, the ocean is interacting with the geosphere and biosphere. This is because of the fact that the earthquake emerged in the undersurface of the ocean is the part of the geosphere. The waves produced due to instability of the undersurface resulted in high speed waves. These waves resulted in drastic floods. The floods caused the destruction of the property of the coast, inland areas, plants and animals which came in contact with the flood. Hence, the biosphere was affected.

8 0
3 years ago
Other questions:
  • An ecologist conducts a greenhouse experiment to study the effect of water concentration added to soil on the productivity of su
    12·1 answer
  • 23.
    6·1 answer
  • Which is considered the father of plate tectonic theory
    5·1 answer
  • Which statement best describes how the distance from a large river affects
    5·1 answer
  • Anyone else think that it's insane that people drink milk that's robbed from calf's?
    15·1 answer
  • Causas, consecuencias, prevencion y medidas de solucion sobre la falta de agua en el mundo
    11·1 answer
  • Imagine you want to learn more about mike smith’s osteosarcoma. how could you use microarray technology to determine which genes
    14·1 answer
  • The domestication and breeding of animals to have as pets, livestock on farms, or for work purposes is a form of artificial sele
    10·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Preparation for genome are made in which phase​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!