1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marishachu [46]
2 years ago
8

What would happen to the size of the mountain lion population if the deer population increased?

Biology
1 answer:
nevsk [136]2 years ago
7 0

Answer:They will be like neon shadow

Explanation:

You might be interested in
Which sentence best captures a central idea of the biography
77julia77 [94]
I can’t see question buddy
5 0
3 years ago
The cytoplasm is the part of the cell in which
notka56 [123]

Answer: Cytoplasm, the semifluid substance of a cell that is external to the nuclear membrane and internal to the cellular membrane, sometimes described as the nonnuclear content of protoplasm. In eukaryotes (i.e., cells having a nucleus), the cytoplasm contains all of the organelles.

HOPE THIS HELPS

5 0
2 years ago
Which type of system or instrument would be best at gathering data on wind
kirill115 [55]

Answer:

Anemometer

Explanation:

It should be understood that the anemometer is different to wind vane in both structure and function.

This is because, anemometer is an instrument that is used to measure the speed of the wind, while the wind vane is used to measure the direction of the wind.

Therefore, in this case, the anemometer is going to be the instrument to measure the speed of the wind above the ocean waters.

4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
What does a thick layer of an ice core tell us? A thin layer?
Elena L [17]
Through analysis of ice cores, scientists learn about glacial-interglacial cycles, changing atmospheric carbon dioxide levels, and climate stability over the last 10,000 years. Many ice cores have been drilled in Antarctica.
7 0
2 years ago
Other questions:
  • A cross between homozygous red-eyed flies and homozygous white-eyed flies results in progeny that all have red eyes. this result
    8·1 answer
  • Why are recessive alleles not removed from populations over time?
    5·2 answers
  • Why does the scientific establishment sometimes reject new ideas?
    8·2 answers
  • The best scientific theories not only explain and organize known facts but also __ __.
    8·2 answers
  • Modern organisms in similar environments often have similar physical
    10·1 answer
  • The organs that supply the stomach with digestive juices are the
    15·2 answers
  • Explain the importance of using engine powered pump for irrigation works.​
    13·1 answer
  • I’m stumped anyone know 4 metamorphosis facts?
    7·1 answer
  • How many cells does one gram of yeast contain? ​
    5·2 answers
  • Hello people ~
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!