1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Setler [38]
3 years ago
12

How are tropical rain forests and temperate forests different?

Biology
1 answer:
Varvara68 [4.7K]3 years ago
7 0

There are two types of rainforests, tropical and temperate. Tropical rainforests are found closer to the equator where it is warm. Temperate rainforests are found near the cooler coastal areas further north or south of the equator. The tropical rainforest is a hot, moist biome where it rains all year long.

<u>known as D</u>

<u></u>

hope this helps <3

You might be interested in
What are downbursts ?
Ray Of Light [21]
<span>a strong downward current of air from a cumulonimbus cloud, usually associated with intense rain or a thunderstorm.</span>
5 0
3 years ago
Read 2 more answers
In the rumen, which portion would have the most papillae?
BlackZzzverrR [31]

Answer:

ventral

Explanation:

5 0
3 years ago
Testing a(n) ____________ involves performing a(n) ____________.
Scrat [10]
<span>hypothesis, experiment i hope it helps!!!</span>
3 0
3 years ago
We can test the relative permeability of a phospholipid bilayer by using a synthetic membrane that does not contain any protein
Deffense [45]

Answer:

Glucose.

Explanation:

The cell membrane is made up of lipid bilayer and proteins are embedded or may span the lipid bilayer. The carbohydrates are present in association with lipids and proteins.

The artificial membrane has been prepared that are free from proteins. Small uncharged particles may easily diffuse through the membrane. Among the given molecules in the question water is the smallest molecule and diffuse out first through the plasma membrane. Ethanol is 2 carbon compound and diffuse after water than glycerol diffuses as it is a 3 carbon compound. Glucose is the largest molecule and diffuse last through the plasma membrane.

Thus, the correct answer is option (A).

4 0
3 years ago
Which biome has the greatest area on earth?
Gnesinka [82]

The largest biome according to land in the world is Taiga, also known as boreal. It covers almost 30% of the world’s forest and by country it covers the land of North America, Canada and Russia. There are many categories of biomes according to their specific quality or reason like dessert, rainfall etc.

7 0
3 years ago
Other questions:
  • Help me ??? which of the following statement is true regarding the process of photosynthesis?
    14·2 answers
  • The major source of building blocks for building new muscle and tissue are found in foods that contain ____.
    12·1 answer
  • Select all of the statements that apply to healthcare-associated or nosocomial pneumonia to test your understanding of the diffe
    6·1 answer
  • Which two main processes take place to produce proteins -A differentiation and specialization B- mitosis and meiosis C-photosynt
    12·2 answers
  • How is the equation for photosynthesis different from cellular respiration?
    10·1 answer
  • H
    9·1 answer
  • 11a+9=4a+30 how do i solve for a
    13·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • What is bioluminescence
    14·1 answer
  • Organisms that use energy to control their internal conditions are
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!