1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Darya [45]
2 years ago
7

During primary growth, the primary xylem and phloem grow alongside each other, except for a layer of tissue in between them. The

se primary tissues will eventually be pushed away from each other during secondary growth. What growth process causes this to occur
Biology
1 answer:
DanielleElmas [232]2 years ago
6 0

Answer: Determinate growth

Explanation:

determinate growth stops when a plant element (such as a leaf) reaches a particular size.

You might be interested in
Describe: how does desert plants carry out photosynthesis?
WINSTONCH [101]
During night, desert plants<span> absorb carbon dioxide and form an intermediate. Then during day time when the stomata is closed to prevent loss of water, they use this stored carbon dioxide to perform </span>photosynthesis<span>.</span>
3 0
3 years ago
What is the composition of the asthenosphere?
BartSMP [9]

The asthenosphere lies 80-200km below the surface under the lithosphere. Convection also occurs in the asthenosphere. The asthenosphere is mostly made of up rock material (magnesium and iron silicates). The asthenosphere makes up 6% of the mantle and lets the lithosphere move.

Best of Luck!

5 0
2 years ago
WHEN ARE TREES CARVED UNDER WHICH CONDITIONS CAN IT GROW UP AGAIN?
skelet666 [1.2K]

Answer:

Explanation:

In critical conditions since when a forest is cut down if it rains the land is not in a condition for trees to flourish since every time it rains you will see a flood devastating any plant that tries to grow.

8 0
2 years ago
What is the purpose of the small holes on the underside of the leaves
Ratling [72]
So carbon dioxide can diffuse from the leaf
6 0
3 years ago
Read 2 more answers
An organism is described as 2n = 48.A) How many chromatids per chromosome are in one meiotic cell during prophase 2?B) How many
Alex

Answer:

A) 48

B) 96

C) 48

D) 48

Explanation:

Attached is a table summarizing the number of chromosomes and chromatids in the different stages of mitosis and meiosis in humans who are described as 2n = 46.

For the organism which is described as 2n = 48, substitute 46 in the table for 48 to get the appropriate figures.

4 0
3 years ago
Other questions:
  • __________ is a substance in food used by the body to promote normal growth, maintenance, and repair.
    14·1 answer
  • Grace recently took a cruise onboard a luxury liner. a few days into her vacation, she developed signs of ____ infection, the mo
    8·1 answer
  • Sally has been tested positive for an infectious disease and does not have any signs or symptoms. sally is known to be a​ ______
    8·2 answers
  • Which terms describe the stem and root of this plant?
    5·1 answer
  • The following flow of energy occurs in the trophic levels in an ecosystem:
    8·2 answers
  • WILL GIVE BRAINLIEST. AND 50 POINTS. Question 9 (1 point)
    14·1 answer
  • How can you face a problem if your problem is your face?
    12·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • A group of organisms of the same species linving in an area is called
    15·2 answers
  • Create a food chain with a producer and 3 consumers.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!