1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex_Xolod [135]
3 years ago
5

There are two types of cell division the first produces cells that are identical to the original cell the second produces cells

that are different from the original cell which type of cell division do you think is responsible for these processes
Biology
1 answer:
kobusy [5.1K]3 years ago
6 0
Mitosis produces identical cells
Meiosis produces cells that are different from the original cell
You might be interested in
Why are lethal dominant alleles so much more rare than lethal recessive alleles?
juin [17]

Lethal alleles cause the death of an organism prenatal or after the birth. Lethal alleles are usually a consequence of a mutation and they can be recessive, dominant or conditional. Since the lethal dominant alleles are harmful whether they are carried in homozygous (e.g.AA) or heterozygous (e.g.Aa) form,  a strong selection against them is present and thus these alleles are much more rare.

5 0
2 years ago
3)Amphibians hatch out of their eggs with:
Lunna [17]

Answer: I'd say the answer would be (A)

Explanation:Depending on the Anphibian, they breathe through their lungs and skin at first and develope Gills later in life. Some are born with gills and lungs. But normally they start with lungs first.

5 0
3 years ago
Scientific method example​
tatuchka [14]

Answer:

There are 5 steps of the scientific method

1. Make a question

2. Do some research for that question

3. Make a hypothesis ( guess what might happen during the experiment)

4. Test and Collect Data

5. Conclusion ( write what happened during the experiment and what you learned)

4 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
A physician examines a patient who complains of breathing problems she finds fluctuations in the patient’s blood pressure and he
igor_vitrenko [27]
The picture won’t load
4 0
3 years ago
Other questions:
  • el clorato de potasio, KCLO3, se obtiene por la accion del cloro sobre la disolucion de hidroxido de potasio KOH en caliente, se
    7·1 answer
  • What is the study of geology an meterology
    10·1 answer
  • COMPLETE<br> Segments of DNA transferred from parent to offspring are called
    6·2 answers
  • What causes the greenhouse effect
    11·2 answers
  • In which aquatic ecosystem does fresh water meet salt water?
    8·2 answers
  • Which level contains the herbivores
    14·1 answer
  • Viral envelopes are made of​
    13·2 answers
  • What is the melting point of a substance
    11·1 answer
  • 11. What crop did Norman Borlaug research to begin the Green Revolution?
    5·2 answers
  • Hemophilia is a disease that causes uncontrollable bleeding. If a father has it, all of his daughters will be carriers of the di
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!