1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
skelet666 [1.2K]
3 years ago
11

Which shows the levels of organizational hierarchy listed from least complex to most complex?

Biology
1 answer:
weqwewe [10]3 years ago
8 0

Answer:

I think the answer to this question is O population, community, ecosystem.

You might be interested in
In Jurassic Park, dinosaurs were created from dinosaur DNA extracted from fossils. Do you think this is science friction or is i
exis [7]
I think it might be possible because they took the nucleus from a sheep and put it inside a sheep embryo and it made an exact clone of the sheep.If they could make a nucleus that could handle the DNA of the dinosaurs and have the nucleus function properly and have the embryo grow properly then it might be possible for them to create dinosaurs.
6 0
4 years ago
Read 2 more answers
What are possible origins of Earth's surface and internal energy?
saul85 [17]

Answer:

The flow of heat from Earth's interior to the surface is estimated at 47±2 terawatts (TW) and comes from two main sources in roughly equal amounts: the radiogenic heat produced by the radioactive decay of isotopes in the mantle and crust, and the primordial heat left over from the formation of Earth.

3 0
3 years ago
Which of the following is an example of a hypothesis?
Lerok [7]
BBBBBBBBBBBBBBBBBBBBBBBB
6 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Why is it important to define what a living thing is?
natali 33 [55]

Answer:

So people know that everything has a value and they should appreciate it.

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • What is the term for a feature that allows an organism to survive better in its environment? *?
    14·1 answer
  • What challenges do you think parasites face in their survival? How can these challenges affect the parasite?
    6·1 answer
  • An estuary is ___
    7·2 answers
  • A ______ plane passes through the breast, hip, and knee on only one side of the body.
    13·1 answer
  • The initial increase in strength seen with weight training is primarily due to
    11·1 answer
  • I need help with dis, the lil box are the definition and I need to match the terms . CAN ANYONE HELP PLEASE ASAP
    7·1 answer
  • The tertiary structure of a polypeptide is the Select one:_________
    7·1 answer
  • Why dont two species occupy the exact same ecologial niche?
    9·1 answer
  • Explain control group
    14·2 answers
  • During an initial assessment, the nurse measures the client's apical pulse and compares it to the peripheral pulse. the differen
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!