1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saul85 [17]
4 years ago
6

Im sorry but i need the answer to this question to...

Biology
1 answer:
finlep [7]4 years ago
8 0

Answer:

A colloid is a heterogeneous mixture in which the dispersed particles are intermediate in size between those of a solution and a suspension. ... Because the dispersed particles of a colloid are not as large as those of a suspension, they do not settle out upon standing.

Hope that helps!♡

You might be interested in
Renin is released by cells of the apparatus in response to afferent arteriole pressure and the degree of stretch of the arteriol
astra-53 [7]

Answer: True

Explanation:

Renin ( angiotensinogenase), is an aspartic protease protein which is secreted by kidney that participates in the body's renin – angiotensin – aldosterone network that mediates arterial vasoconstriction and extracellular fluid volume.

Renin is released by cells of the juxtaglomerular apparatus in response to the stimuli of decrease in arterial blood pressure and the degree of stretch of the arteriole wall.

Hence, the statement is true.

4 0
3 years ago
Granite is an igneous rock which is not easily___
sweet-ann [11.9K]

Answer:

Eroded.

Explanation:

Granite is pretty much impervious to natural weather.

6 0
3 years ago
If a species has a 2n number of 18, how many autosomes would their SOMATIC cells have?
Zanzabum

Answer:

If a species has a number of chromosomes 2n = 18, then its somatic cells have 16 autosomes.

Explanation:

Somatic cells are diploid, that is, they have the complete chromosomal charge, and it is represented as 2n. In organisms with sexual reproduction the chromosomes are divided into autosomes and sex chromosomes, which are 2.

<u>If a species has a number 2n = 18, it means that its somatic cells have 18 chromosomes, of which 16 are autosomes</u> and 2 are sex chromosomes. Autosomes contain the structural and functional characteristics of an individual, while the sex chromosomes determine sex.

7 0
3 years ago
A dna molecule has the sequence gcatccga. what is the mrna sequence resulting for this dna code?
Yuliya22 [10]
The answer is CGUAGGCU. Also this link is a link to a key of the assignment you might have.
Download pdf
3 0
3 years ago
What makes some people prefer hot and spicy foods, while others may sweets?
Andreyy89
Upbringing and habit
8 0
3 years ago
Other questions:
  • While washing her hair Olivia noticed that she was losing a lot of hair she visited a clinic and the physician Reassured her tha
    7·1 answer
  • In griffith's experiments, what happened when heat-killed s-strain bacteria were injected into a mouse along with live r-strain
    8·1 answer
  • Why are diatoms important to the ecosystem beyond being food?
    11·1 answer
  • Choose a plant or animal that you think is interesting. describe some of the threats or challenges
    6·1 answer
  • A client with a significant history of mitral valve prolapse is receiving client education regarding dietary recommendations to
    15·1 answer
  • When reviewing the history of a patient who will be taking an antifungal drug?
    15·1 answer
  • Changing a river into a lake is basically what a large dam does. One reason we do this to create reservoirs of fresh water. What
    13·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Sodium (Na) and water (H20) undergo a chemical reaction
    9·1 answer
  • What is the primary use of amino acids within the protein metabolism?.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!