1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
viktelen [127]
3 years ago
10

Im 4 and my sis is 13. SHE told me she was on her period but then I told her there was this thing called subject and predicate a

nd how she isnt supposed to have a period at the end of her statement because it wouldnt make any sense... and ya, it didnt go well cause' she put on a tantrum.
But the weird thing is that Google said this "Tantrums are most common between the ages of one and four, then decrease when children start school." SO HOW COME I DIDN"T HABE A TANTRUM!! life makes no sense.

P.S: I even saw mom buying DiApERS for her! Like I stopped my diapers and got potty trained about 1 or 2 months ago and IM 4yrs old. SHE IS 13.

man she must have a hard time walking with those things in her short skinny pants.
AND lm A boy by the way.
Biology
2 answers:
N76 [4]3 years ago
7 0

Answer:

Please destroy your tablet.

Explanation:

First of all, why are you on Brainly when you're 4.

And second of all, you're sister is wearing short pants, so she is going through a lot right now. Even 13 year old's have tantrums.

Vedmedyk [2.9K]3 years ago
3 0

Answer:

Stop the cappin

Explanation:

You might be interested in
What is the powerhouse of the cell?
lubasha [3.4K]
The mitochondria is the powerhouse of the cell because it produces ATP, which is energy.
3 0
3 years ago
Read 2 more answers
What is a disease caused by chronic malnutrition in childhood in which a protein deficiency makes the child more vulnerable to o
scoray [572]
Kwashiorkor, i believe.
4 0
3 years ago
After a coma of 30 full years, is it mandatory to have to learn to walk or can some people remember how to walk? Also, after a c
PilotLPTM [1.2K]

Answer:

after being in a coma for 3 weeks you need to learn how to walk, also being 30 years in a coma is not possible because the doctors would have let you go off of life support.

Explanation:

3 0
3 years ago
Is a line graph created when
AlexFokin [52]
The answer is C your welcome (:
4 0
3 years ago
Question 2 Multiple Choice Worth 3 points)
Nataliya [291]

Answer:

contact forces is answer

4 0
2 years ago
Other questions:
  • In living things, hydrolysis reactions result in the formation of
    7·1 answer
  • Which group of mammals exhibits the widest distribution and greatest diversity?? a. ?cetaceans b. monotremes c. ?primates d. ?pl
    5·1 answer
  • Is a tomatoe a fruit or vegetable
    8·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which cell structures are seen in prokaryotic and eukaryotic cells?
    14·1 answer
  • Why are they called amino acids?
    5·1 answer
  • Which of these contributors will transfer the greatest amount of carbon into the atmosphere while reabsorbing the least amount o
    12·2 answers
  • All organisms on the top of an energy
    12·1 answer
  • Three plants are grown in the same environmental conditions with equal sunlight, water, and space to grow. One plant grew to hav
    7·1 answer
  • Name five dygestive enzymes secreted by the intestinal glands​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!