1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ierofanga [76]
3 years ago
7

What is a gene?What number should replace the letter x in the “Seed color” row?

Biology
1 answer:
Goryan [66]3 years ago
6 0

1. A gene is section of DNA that codes for a specific trait.

2. 2,001

You might be interested in
2. The option that correctly represents fungi's mode of nutrition in two and five
Elis [28]

Answer:

Heterotrophic Autotrophic

6 0
3 years ago
1. Which of the statements below best describe marketing?
Ainat [17]

Answer:

1. A

2. D

3. A

4. B

This is the answers

6 0
3 years ago
Help please with a cherry on top
Veronika [31]

Answer:

text 1 - while we may know what's coming ahead of time, weather remains unpredictable

text 2 - the coastal regions experience the most damage...

text 3 - modern technology utilises energy to predict...

text 4 - hurricanes are intensely powerful storms that are only growing more intense

text 5 - meteorologists can make predictions of hurricane movement...

5 0
3 years ago
Identical twins occur when a(n) _____ divides to form two separate individual cells
jeyben [28]
Embryo should be the answer
8 0
3 years ago
two students used two balls to make a scale model of the earth/moon system. the earth model was 24 cm in diameter. when they fin
olganol [36]
576 is the final numbers
8 0
3 years ago
Other questions:
  • How do each of the three eggs placed in solution compare to the control egg?
    14·2 answers
  • Solve for v<br>negative 38= v/2
    11·1 answer
  • How do adaptations affect natural selection
    13·1 answer
  • Explain how and why hypertonic, isotonic, and hypotonic solutions affect plant and animals cells?
    11·1 answer
  • Variations within a species are probably caused by:
    11·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • How might studying these brain organoids help patients with these disorders?
    8·1 answer
  • What is the full account of yeast​
    5·1 answer
  • Example of natural system of classifying organisms​
    10·1 answer
  • La cantidad de energía que llegaría al cuarto nivel trófico en un ecosistema
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!