1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikitadnepr [17]
3 years ago
9

Cual es la relacion entre la disponibilidad y el consumo de recursos renovables y no renovables entre los paises desarrollados y

los paises en vias de desarrollo
Biology
1 answer:
Crazy boy [7]3 years ago
4 0

Answer:

Diferente.

Explicación:

La relación entre la disponibilidad y el consumo de recursos renovables y no renovables entre países desarrollados y en desarrollo es diferente debido a la presencia de tecnología que permite a los países desarrollados utilizar sus recursos renovables y no renovables disponibles. Los países desarrollados están más avanzados que los países en desarrollo en el campo de la tecnología y también la economía, por lo que pueden utilizar recursos renovables en comparación con los recursos no renovables.

You might be interested in
TRUE/FALSE All proteins structures are related to their function​
irina [24]

Answer:

True

Explanation:

a protein's unique shape determines its function.

6 0
2 years ago
55 Which of the following is an advantage of
Savatey [412]

<u>Answer</u>:

"It increases the mutation rate"  is an advantage of  sexual reproduction

<u>Explanation</u>:

The basic thing of evolution is fundamental, as it helps in generation of genetic variation on which the selection can act. Sexual reproduction leads to genetic diversity, and this genetic diversity leads to increase the mutation rate. Genetic diversity occurs because of two various cells which are combining together and biological assortment which happens at the time of cell division. Neutral genetic diversity in the population leads to high mutation rate.  

4 0
3 years ago
Based on the assumption that individuals seek to maximize the return (in calories and nutrients) on their labor, __________ is a
erma4kov [3.2K]

Based on the assumption that individuals seek to maximize the return (in calories and nutrients) on their labor,<u> age and gender </u>is a model used by anthropologists to how food collectors decide which animals and plants to hunt or collect and which to ignore.

<h3>What is the meaning of "Labor"?</h3>

In its most basic sense, the term "labor" refers to employment that requires heavy manual labor, typically performed by unskilled laborers. However, the term "labor" in economics refers to manual labor. It also requires mental effort. In other words, work that is done physically or mentally in exchange for payment is considered labor.

<h3>What exactly does an anthropological do?</h3>

When it comes to human origins, physical, social, linguistic, and cultural development, behavior, and the cultures, organizations, and institutions that people have built over time, anthropologists study, assess, and help shape public policy.

Learn more about Labor here:-

brainly.com/question/606333

#SPJ4

6 0
1 year ago
A scenario where a cell may need to perform a form of endocytosis
Mademuasel [1]

There are so many examples for that in different areas, like TPBA experiment carried out in our lab recently.Here's one link: http://www.alfa-chemistry.com/tpba-cas-172285-72-2-item-294462.htm

7 0
3 years ago
An athlete wants to eat a meal that will give them quick energy. Which of the following
Oksi-84 [34.3K]
Carbohydrates

Because they r known as energy giving food
6 0
3 years ago
Read 2 more answers
Other questions:
  • How do trees adapt to ensure their survival after a fire??
    6·2 answers
  • In the Sierra Nevada mountains of California, there are many populations of the checkerspot butterfly, Euphydryas editha. You no
    7·1 answer
  • Can someone explain to me in depth the difference between covalence and ionic bonds
    10·1 answer
  • Earth’s first life forms were __________. aerobic cyanobacteria photosynthetic chemoautotrophs
    12·2 answers
  • 2 examples of gene flow
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • PLEASE HELP!!!!<br> IT IS FOR BIOLOGY
    12·1 answer
  • What is the difference between good ‘seeing’ and good ‘transparency’? Give one condition for each.
    12·1 answer
  • what is the major difference between the normal stomach cells and cancerous stomach cells of the chicken?
    10·1 answer
  • What event at letter b leads to elongation of the bone?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!