1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juliette [100K]
3 years ago
13

Which conclusion about the meaning Of Y is correct if the allele combination Yy is for yellow seeds?

Biology
2 answers:
vaieri [72.5K]3 years ago
5 0
<span>I can infer that the importance of the Y is yellow and prevailing is the allele mix Yy is for yellow seeds. Yy implies that the phenotype demonstrated will mirror the capital letter, or the overwhelming one, which ends up being yellow. In the allele combination Yy, the Y is more dominant over y. If the combination equals yellow seeds, therefore, Y must be yellow seeds</span>
gizmo_the_mogwai [7]3 years ago
4 0
<span>In the allele combination of Yy, its a mixed combination. If the color of the seeds is yellow, then that means Y. i.e., the dominant allele represent yellow color. y represents some other color, but it is recessive and therefore, could not express itself in this generation.</span>
You might be interested in
Which human activity has been banned in most areas because of its negative impact on the biosphere?
Ugo [173]
The human activity banned is restaurandts and most public areas is smoking
6 0
3 years ago
Diarrhea is defined by loose, watery stool (poop.) Diarrheal diseases kill millions of people worldwide every year. Describe how
Alex

Answer:

dehydration.

Explanation:

the body is loosing more fluid than it is able to keep in and extreme cases result in death

4 0
3 years ago
Which is a correct interpretation of the cladogram shown below?
swat32
Earth worm is ur awenser
8 0
2 years ago
Population A consists of 100 hens that are fully isogenic and that are reared in a uniform environment. The average weight of th
qaws [65]

Answer:

a. the environmental variance (VE) = 3.5 g ²

b. 17.5 g ² for population

c. the heritability of broad sense (H2) = 0.83

Explanation:

a.With the information we have we can infer that environmental factors influence A, which is considered isogenic, thus, the environmental variance (VE) = 3.5 g ²

b.When studying population B, comparing it without environmental changes with respect to population A, we found that its total variance (VT) = 21.0g ²

We generate the following formula with the data obtained previously to find the genetic variation

VT = VE + VG

then VG = VT-VE

replacing data:

VG = 21.0 - 3.5 = 17.5 g ² for population

c. Regarding the heritability of broad sense (H2) in population B, we can reach the result with the data previously obtained like this:

H2 = VG / VT = 17.5 / 21.0 = 0.83

7 0
3 years ago
mc004-1.jpg Photo by NIH/Bill Branson Which type of bond is found in many carbon-to-carbon bonds in canola oil, but very few car
Xelga [282]
One of the main differences between butter and canola oil is that are room temperature one is a solid and the other is a liquid. This change in phase is due to the bonding between carbon bonds, the more double bonds that there are present the higher the melting point and the fluidity changes. Based on this the correct answer is C=C is found in canola oil while more C-C bonds are found in butter, making option 2 (C=C) the correct answer. In addition option 3 (C=H) can be ignored since hydrogen can only make single bonds. hope this helps:)

7 0
3 years ago
Other questions:
  • What could be the reason for this
    9·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • How is mitosis different in plants and animals
    7·1 answer
  • when fossil fuels are burned they produce what the main greenhouse gas responsible for global warming trends
    11·2 answers
  • The mucosa of the appendix contains masses of lymphoid tissue (MALT) and therefore leukocytes capable of attacking bacteria are
    9·1 answer
  • How does predation affect population cycles
    7·1 answer
  • Find the value of x :(6-x°)​
    8·1 answer
  • Place the following categories from broadest to most specific
    6·1 answer
  • What makes an energy resource non-renewable? <br><br>Please explain well, will give brainliest.​
    14·1 answer
  • Calories from saturated fats and/or added sugars in foods that have little or no nutritional value, such as sausages and ice cre
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!