1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zanzabum
3 years ago
10

When should you figure out what the constraints and criteria are?

Biology
2 answers:
Margarita [4]3 years ago
4 0
The third one is the correct answer I hope this helped
stellarik [79]3 years ago
4 0
When you are defining the problem
You might be interested in
How do breakers form?
djyliett [7]
Breakers form when a wave approaches the shore, it grows in height and steepness as the water gets more shallow. Afterwards the waves grow and till the deep part of the water isn’t as deep anymore. At this point, the wave breaks and in results it forms a breaker.
4 0
3 years ago
Read 2 more answers
In a genotype such as Bb, what does each letter represent?
-Dominant- [34]

I believe the capital b (B) is refered to as the dominant gene and the lower case b (b) is refered to as the subordinate/recessive gene.

4 0
3 years ago
An isotope is an Atom with different number of what?
Rudiy27

Answer:

D.they are three different elements

Explanation:

Google

4 0
2 years ago
Read 2 more answers
WILL GIVE BRAINLYEST
Andreyy89

Answer:

J'aiderais, mais s'il y avait plus d'informations, je les comprendrais mieux pour moi et pour les autres utilisateurs également.

Explanation:

ლ(´ڡ`ლ)

6 0
3 years ago
Small insects can walk across the surface of calm water. Their feet push the surface of the water down slightly, somewhat like a
Liono4ka [1.6K]

Answer:

Explanation:

Molecules within a liquid are pulled in all directions by intermolecular forces; there is no tendency for them to be pulled in any one way. However, molecules at the surface are pulled downward and sideways by other molecules, but not upward away from the surface. These intermolecular attractions thus tend to pull the molecules into the liquid and cause the surface to tighten like an elastic film.

A measure of the elastic force in the surface of a liquid is surface tension. The <em>surface tension</em><em> is the amount of energy required to stretch or increase the surface of a liquid by a unit area</em>.  Surface tension enables small insects, like the water strider, to “walk” on water.

5 0
3 years ago
Other questions:
  • Explain how natural selection
    11·1 answer
  • What is the relationship with hypothesizing and experimenting in science?
    14·1 answer
  • Which specialized organelle is shown
    7·2 answers
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • How do messages travel from one neuron to another
    12·1 answer
  • Why is there essentially no waste in the natural world except for waste generated by humans?
    10·1 answer
  • Which enzyme functions to prevent supercoiling of the DNA molecule during replication?
    5·2 answers
  • . Which statement accurately describes the energy needs for photosynthesis and cellular respiration?
    9·1 answer
  • Some organisms reproduce sexually. Other organisms reproduce asexually. What are some benefits of asexual reproduction?
    6·2 answers
  • There are 3 main categories of environmental problems that have come about because of the population growth. What are they and e
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!