Answer
Option C - Skeletal Muscles
Explanation
Antagonistic pairs are the muscles that are functionally opposite, if one produces flexion, then the other's primary action is an extension. Skeletal muscles work in pairs to move a bone so that the muscles can function properly. They contract the bone making nerves deliver a message to the brain. For example. Biceps and triceps. The lower arm is moved upwards when the biceps muscle contracts and the triceps muscle is relaxed and vice versa.
The correct answer is A.
The use of antibacterial drugs can cause modifications in the genetic material of the concerned bacteria. If the genetic material of the bacteria are modify, that means they have undergone mutation. Because the base sequence of the normal and that of the mutated gene is different, antibiotic will not be able to recognize the bacteria again and thus will not be able to attack it.
Answer:
If many people buy plastic products, these products will still be around 100 years from now, piled in landfills or other storage sites.
Explanation:
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
