Answer:
Diffusion is the movement of molecules from an area where the molecule is in high concentration to an area where the molecule is in lower concentration. ... Facilitated diffusion is the movement of a molecule from an area of high concentration to an area of lower concentration with the help of a protein channel or carrier.
Explanation:
follow god :)
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
a feedback mechanism that maintains homeostasis
Explanation:
Anhidorosis mostly directly interferes with a feedback mechanism that interferes directly with a feedback mechanism that maintains homeostasis.
Since anhidorosis is the inability to properly or normally sweat, it affects the process of homeostasis.
Homeostasis is an important characteristics of life.
It is the ability of organisms to maintain and sustain a balance environment within and outside of them.
Sweating is one such process by which the body carries out homeostasis. On a hot day, the body produces sweat which evaporates and release latent heat to cool the body. This inability affects the intricate balance between the environment and the body.
learn more;
Homeostasis brainly.com/question/1601808
#learnwithBrainly
I hope this helps
The compatibility of a person’s temperament with his surrounding environment is referred to as “goodness of fit.”
Some temperaments and environments seem to naturally fit together, while others do not.
There are two types of “Goodness of Fit:”
<span>
how that trait interacts with the environment
how it interacts with the people in that environment.
</span>
Any trait in and of itself is not a problem; rather, it is the interaction that determines the “acceptability” of that trait.
