1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SSSSS [86.1K]
2 years ago
9

50 points! b)separates sections of DNA by size in order to isolate specific genes. (1 point)

Biology
2 answers:
makkiz [27]2 years ago
5 0
Gel Electrophoresis I believe
stellarik [79]2 years ago
4 0

Gel electrophoresis is a technique used to separate DNA fragments according to their size. This is from Khan academy so I believe it is reliable.

You might be interested in
Consider the pH range of various solutions. How many of the solutions were in the basic range on the pH scale?
stira [4]
I’m pretty sure it’s zeroooooooo
8 0
3 years ago
Read 2 more answers
A covalent bond is formed by
devlian [24]
Atoms sharing valance electrons
7 0
2 years ago
After you have established a research question, which of the following should you do first?
Nastasia [14]

Answer:

After you have established a research question, which of the following should you do first?

put your research question into a null and alternative hypothesis

Explanation:

It expedient that after research question has been established, one needs to make a null hypothesis and alternate it, this gives a clue of what the researcher intends to find or problem to be solved.

7 0
3 years ago
Care sunt toate diferentele dintre sistemul circular al unei reptile si al unui om
dusya [7]

Answer:

Human has 4 chambers, and most reptiles have 3 chambers in their heart

Explanation:

your question in Romanian translated roughly What is the difference between a human and reptile circulatory system?

5 0
2 years ago
The cost of researching technology to extract alternative fossil fuels, such as oil sands and oil shale, is high. Do you think t
Margarita [4]

Answer:

I don't think this is good

Explanation:

if there was a machine it would be good

because as coal it harms our environment from harmful drty gases

3 0
3 years ago
Read 2 more answers
Other questions:
  • How many neutrons does element X have if its atomic number is 41 and its mass number is 162?
    9·1 answer
  • There is no sound in the vacuum of space. Why?
    13·1 answer
  • What supports more life relative to their area- freshwater ecosystems or marine ecosystems? why?
    7·1 answer
  • How many millimeters of water would be displaced by 48 g of lead
    14·1 answer
  • The cytoplasm of a certain cell, such as a neuron, already has a high concentration of K ions. How can K ions continue to enter
    12·1 answer
  • In the cross BB x bb, the percent of offspring in the F1 generation that will have the same genotype as one of their parents is
    14·2 answers
  • In the early part of the twentieth century, who owned most of the farms?
    13·2 answers
  • Mary is a carrier for a mutated gene that causes sickle cell disease. Which of the following statements is true about Mary?
    11·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • 4 A reaction that needs water,<br> macromolecules are broken down<br> ( biochemistry )
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!