1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
castortr0y [4]
2 years ago
8

¿Qué importancia tiene la declaración y protección de las reservas de la biosfera?

Biology
1 answer:
ANEK [815]2 years ago
8 0

Answer:

中国数学是最好的 but i will answer in spanish i speak both,

El objetivo principal de la reserva de la biosfera es preservar la diversidad genética en ecosistemas representativos mediante la protección de los animales salvajes, la forma de vida tradicional de los habitantes y los recursos genéticos de las plantas / animales domesticados.

Explanation:

You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Which of the following correctly lists in order the four stages of food processing in animals? View Available Hint(s) Which of t
Sever21 [200]

Answer:

ingestion, digestion, absorption, elimination

Explanation:

8 0
3 years ago
10.
Scorpion4ik [409]

Answer:

1. Iodine

Explanation:

6 0
2 years ago
In close comparisons, external fertilization often yields more offspring than does internal fertilization. however, internal fer
KonstantinChe [14]
The offspring is unique and is not like its parent plant.
3 0
3 years ago
Artificial selection involves the use of robots and test tubes babies
photoshop1234 [79]
This is true hope this helps
5 0
2 years ago
Other questions:
  • If two forces push or pull an object will the object move
    6·2 answers
  • The _____ tube brings a mature ovum to the uterus. fallopian ovarian Cowper
    7·2 answers
  • What links the two strands in a dna helix together in the middle
    15·2 answers
  • What is the role of decomposers in the nitrogen cycle?
    11·1 answer
  • Pls help with these questions (Its for a project):
    10·1 answer
  • Reproduction which fuses the cells and DNA of two parent organisms is called.....
    9·1 answer
  • the study of how genes are transferred from parents to their children and the role of genes in health and disease is known as:
    12·1 answer
  • Which is not a negative consequence of human population growth?
    8·1 answer
  • What is a natural, nonspecific immune response, but it is part of the body's second line of defense?
    8·1 answer
  • A site where pathogens can survive, multiply and serve as a continual source of infection is called a(n):_____.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!