1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lord [1]
3 years ago
7

Differences between Mexican and American constitution ?

Law
2 answers:
Vinil7 [7]3 years ago
7 0
One is written in the english language while the other is written in the spanish language.
Zinaida [17]3 years ago
3 0
It introduced the system of federalism in a popular representative republic with Catholicism as official religion. The 1824 constitution does not expressly state the rights of citizens. ... The Mexican nation adopts as its form of government a popular federal representative republic. 6.
You might be interested in
Because a prison is very old and overcrowded, a state court orders the state legislature to spend $100 million on a new prison
s2008m [1.1K]
Limited Government: Fundamental notion of Constitution. National government has limited power with regulation over only those rules in Article I of the Constitution.
●Separation of Powers: Three branches of government. Meant to keep one branch from becoming too powerful.
5 0
2 years ago
What’s the importance of Steagald v United States? And do you agree with the decision?
nlexa [21]

Answer:

The decision of the Supreme Court on Steagald v United States (1981) established that according to the Fourth Amendment, police officers can´t search for a suspect in a third party´s property without getting a search warrant first.

Explanation:

According to the Supreme Court, the search carried in the house of the petitioner, Gary Keith Steagald, which was conducted only with an arrest warrant for Ricky Lyons, and led to Steagald´s arrest, was a violation of the exclusionary rule stated in the Fourth Amendment that protects all citizens from illegal searches and seizures. I do agree with this decision because any effort to apprehend a suspect should never infringe nor his or a third party´s constitutional rights.

7 0
2 years ago
Title ix is a comprehensive federal law that prohibits discrimination on the basis of _______ in any federally funded education
Andrei [34K]

Title IX aims to prevent any sort of discrimination in schools that receive federal funding based on sex.

Title IX:

  • Is a federal law that was enacted in 1972
  • Aims to prevent discrimination based on sex in any educational program and institution that receives federal funding

Sex was not specifically protected in the 1964 Civil Rights Act in terms of educational institutions. Title IX was therefore passed to rectify this and the federal government enforces this by making action against sex based discrimination, a requisite for receiving federal funding.

In conclusion, Title IX aims to prevent sex-based discrimination in schools and other educational institutions and programs.

<em>Find out more at brainly.com/question/16080067. </em>

8 0
2 years ago
Please post detailed answers to the following questions. Please use complete sentences!!!
stich3 [128]

technically this is asking your own personal opinion but i will give an asnwer based on my knowledge of it:

"In my personal opinion, it is an unfair clause. If a criminal were to go to court for a crime and walk free he would never be able to be accused of that crime in the future. Detectives are always making new leads in cases and if they were to find any new eveidence, no matter how incriminating it was they would not be able to arrest him a second time.

4 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • Political parties are expected to serve the Interests of_
    8·1 answer
  • I will give you 44 points if you tell me what is AIR FORCE 1 called after the president leaves office?
    13·1 answer
  • What is the difference between probation supervision and intensive probation supervision
    14·1 answer
  • Victims can avoid being at fault for being bullied by:
    5·1 answer
  • What is the difference between public forum and private property?
    6·1 answer
  • Debates in the us congress allow members of congress to:
    8·1 answer
  • Question 11 (1 point)
    12·1 answer
  • Here is the information Jordan has found about several different arson charges.
    6·1 answer
  • In the United States, a winning defendant may recover legal fees from the losing party if they prove ____________.
    12·2 answers
  • What factor should a plaintiff consider when deciding which interference tort applies to a situation?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!