1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nexus9112 [7]
3 years ago
9

Courts __________ the law and then determine how to apply the law to the given situation

Law
1 answer:
icang [17]3 years ago
7 0

Answer:

determine the facts and apply the law.

Explanation:

You might be interested in
Question got deleted, what is eminent domain?
Stella [2.4K]

Answer:

It has something to do with the goverment and housing, mostly like an housing agrent i am pretty sure

Explanation:

5 0
2 years ago
Cinco ejemplos de sometimiento sufrido por mujeres
Free_Kalibri [48]

Answer:

A lo largo de la historia y hasta el surgimiento del movimiento feminista, las mujeres se encontraron en un lugar relegado en la sociedad. Varios son los ejemplos de esta situación, entre los que podemos mencionar:

-el sometimiento ideológico, al prohibirseles el voto hasta bien entrado el siglo XX. Hasta hace 100 años atrás, las mujeres no tenían la posibilidad de expresarse en las urnas.

-las mujeres, en sus trabajos, aun hoy en día sufren discriminación salarial: cobran menos que los hombres por el mismo trabajo realizado.

-la total dependencia de los labores domésticos, los cuales son otorgados en forma egoísta a la mujer por parte del hombre. La mujer muchas veces ocupa un rol de "sirvienta" al servicio del hombre, completando todos los quehaceres de la casa sin ayudas.

-el sometimiento económico, por el cual en el pasado no se permitía a la mujer trabajar, con lo cual se la hacia absolutamente dependiente económicamente del hombre.

-la desigualdad en los puestos de poder entre hombres y mujeres, la cual se ve explicitada en la proporción de mujeres con altos cargos políticos en comparación con la cantidad de hombres en los mismos.

3 0
3 years ago
Now write a CV with Cover Letter to the Head of the Department of Bangladesh House Building Finance Corporation for the post adv
Darina [25.2K]

To, The Head of Finance

Dear Sir,

I have recently seen your advertisement regarding the vacant post in the finance department of your organization. I am CFA and has recently started pursuing MBA finance to enhance my skills and professional knowledge.

I have more than 3 years of experience in the field of finance and have achieved employee star award for my exceptional performance.

I have enclosed my CV for your reference.

CV Sample

Huma Saeed +471 26 555 257

Professional experience :

Bank al Hamra 2016 - 2018

Michael page 2018 - present

Qualification:

Bachelors 2014

CFA 2015-2017

MBA 2017 - Present

Learn more at brainly.com/question/24374352

3 0
2 years ago
What states can you sue for alienation of affection.
Contact [7]

Answer:

  • Hawaii
  • Illinois
  • Mississippi
  • New Mexico
  • North Carolina
  • South Dakota
  • Utah
8 0
2 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
2 years ago
Other questions:
  • What is the difference between a naturalized citizen and a natural-born citizen?
    5·2 answers
  • Demitri has noticed a friend of his talking to his girlfriend He can be very jealous. One day he decides to teach this friend a
    8·1 answer
  • Law is a practical discipline; theory has no place in law.with specific references to the law of contact.discuss
    10·1 answer
  • Please help word cross puzzle
    13·2 answers
  • Was a leader chosen in your group? Did a leader emerge? (In complete sentences and take your time please and thank you)
    11·1 answer
  • Describe the current constitutional rights afforded to prisoners.  Do you think that prisoners have too many or too few rights?
    10·1 answer
  • my original brainly account got deleted how do i get it back it has a xxx.tentacion profile picture on it with all my friends an
    7·2 answers
  • Southbend School District searched for a new learning management system for use in its school district that serves approximately
    11·2 answers
  • Law in the U.S. comes from England’s common law that results from custom and practice. That means decisions are based on: A.prec
    15·1 answer
  • 56 points easy. !!!!?????
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!