1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slavikrds [6]
3 years ago
14

Which was the normal household pattern in early china?

Biology
1 answer:
kykrilka [37]3 years ago
6 0
As many as 5 different generation can be living in one household or in walking distance of each other.
You might be interested in
How does the shape of a plant cell differ from that of an animal cell
const2013 [10]

Answer:

A plant cell is more rectangular than an animal cell

Explanation:

8 0
3 years ago
Human ovaries play an important role in reproduction. Which part of a
Zina [86]

Answer:

c stem

Explanation:

6 0
3 years ago
Which of the following is a trait that links modern primates into a single taxonomic group?
swat32

Answer:a. Retention of five functional digits on the tore and hindimbs

Explanation:

The presence of five digits or pentadactyly on the fingers as well as on the toes makes the primates distinct from other mammals. Also the keratin nails are present on each digit makes these organisms distinct from other mammals.

The five digits on the hindlimbs helps in grip of objects and on toes helps in climbing.

6 0
3 years ago
The function of pure lines: ?
MrRissso [65]

Answer:

The definition of a pure line is a result of inbreeding where animals or plants have certain characteristics that are the same through generations. An example of a pure line is the result of inbreeding of a certain flower to help it fight off diseases.

6 0
3 years ago
How are solar cells used today?
dezoksy [38]

Answer:

<em><u>Solar Cell for Transportation.</u></em>

<em><u>Solar Cell for Transportation.Solar Cells in Calculators.</u></em>

<em><u>Solar Cell for Transportation.Solar Cells in Calculators.Solar Cell Panels. </u></em>

Explanation:

hope this helps you!!

4 0
3 years ago
Read 2 more answers
Other questions:
  • The region of the optic nerve lacking photoreceptor cells is known as the ________.
    5·1 answer
  • What are recessive alleles?
    15·2 answers
  • If a forest was destroyed what will most likely happen to the soil
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Wha is a factor that keeps earth in orbit around the sun?
    12·1 answer
  • In a certain variety of chicken, some offspring have a feather pattern that is black-and-white checkered. Chickens with this che
    7·1 answer
  • Is the composition of air consistent
    7·2 answers
  • Please help me i'll give brianliestttt
    9·1 answer
  • When bacteria make their own food they are called
    14·1 answer
  • Why do children with junctional epidermolysis bullosa have fragile skin
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!