Certain drugs may prevent the unregulated reproduction of cells. Which process was the

Biology

1 answer:

const2013 [10]2 years ago

6 0

Answer:

Cell Division

Explanation:

Cells reproduce by the process of CELL DIVISION, which is the formation of an increased number of cells from a single parent cell. Mitosis is the type of cell division used for the multiplication of cells as it involves the synthesis of two identical number of daughter cells from a single parent cell.

However, certain drugs that may prevent the unregulated reproduction of cells is trying to directly affect the process of cellular division in that cell. This is because cell division is the way through which cells reproduce themselves.

You might be interested in

Bacteriophages that induce bacterial cell lysis are called

uranmaximum [27]

Answer:

Bacteriophages that induce bacterial cell lysis are called virulent phages.

Explanation:

Bacteriophages correspond to viruses with an affinity for prokaryotic cells to be used as hosts for replication. They act both by invading the bacterial cell and by introducing their genetic material into it.

Some bacteriophages are capable of lysing or destroying the host bacterial cell after replication of their genetic material, receiving the name of virulent phages.

6 0

2 years ago

Which of the following is common to both eukaryotic and prokaryotic cells?

Helga [31]

Prokaryotes don't have a nucleolus as they do not have a nucleus, and neither do they have a Golgi apparatus. A nucleoid is loose DNA which is found in prokaryotes but not in eukaryotes...

8 0

2 years ago

Read 2 more answers

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a

frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0

2 years ago

A planet has a mass of 5.97 x 1024 kg and a radius of 6.38 x 106 m. Find the weight of a 65.0 kg person at 1000 km above the sur

mote1985 [20]

Answer: The weight of the person above the surface of a planet is 635.83N.

Explanation:

To calculate the weight of a person, we use the formula:

$w=mg$ ....(1)