Women were expected to:
-be mothers and care for children
-cook for their families
-clean after their families
Men were expected to:
-work for financial security
-protect their families
So we’ll just use “R” and “r” for this example. If the mother AND father are heterozygous, then both of their genotypes are “Rr” if you work out the lumber square or use the foil method, the box would look like this: RR on top left, Rr on top right, Rr on bottom left, and rr on bottom right. So the genetic probabilities, using four as the sum would be 1:2:1
Answer:
Si no es posible refutarla, dicha teoría queda «corroborada», pudiendo ser aceptada provisionalmente, pero no verificada; es decir, ninguna teoría es absolutamente verdadera, sino a lo sumo «no refutada».
Explanation:
Si no es posible refutarla, dicha teoría queda «corroborada», pudiendo ser aceptada provisionalmente, pero no verificada; es decir, ninguna teoría es absolutamente verdadera, sino a lo sumo «no refutada».
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Answer:
In multicellular organisms, the mechanism most directly responsible for directing development and maintaining homeostasis is gene "regulation"
Explanation:
Even though the organs present throughout the body helps in maintaining the homeostasis, But the systems like endocrine system and nervous system plays important role in sustaining and regulating it. The gene regulation is the increase and decrease of the specific gene products. Gene regulation can also be understood as the regulating process which helps in controlling ability of the cell to the environmental changes or can say the adaptability of the cell to changing environment done by gene regulation.
