1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pashok25 [27]
3 years ago
12

Factors that inhibit photosystem II

Biology
1 answer:
zhuklara [117]3 years ago
5 0

Answer:

Inhibition of the activity of photosystem II (PSII) under strong light is referred to as photoinhibition. This phenomenon is due to an imbalance between the rate of photodamage to PSII and the rate of the repair of damaged PSII.

This is the Answer for your question :3

I hope you are having a great day ❤️❤️❤️

You might be interested in
A change in which factor will affect the rate of reaction only when gases are involved?
svetoff [14.1K]

Answer;

-Change in pressure.

Explanation;

-Increasing the pressure on a reaction involving reacting gases increases the rate of reaction.  If you increase the pressure of a gas, you squeeze it into a smaller volume.

-When you increase the pressure, the molecules have less space in which they can move. That greater density of molecules increases the number of collisions. When you decrease the pressure, molecules don't hit each other as often and the rate of reaction decreases. Pressure is also related to concentration and volume.

3 0
3 years ago
Read 2 more answers
What is the rate of temperature change as the air warms up from 52C at 6:00am to 68C at 10:00an?
PSYCHO15rus [73]

Answer:

4C/hr

Explanation:

68-52=16 gives us the temp change, so you divide it by 4 hours for the temp increase each hour 16/4=4

6 0
2 years ago
Explain how the development and improvement of microscopes changed the study of living organisms.
nlexa [21]

Answer: As scientists started improving on the microscopes, the more they got to observe the cells in depth. Compound light microscope uses visible light to produce a magnified image and doesn't allow it to scatter.

3 0
3 years ago
if you find an igneous rock that is made entirely of crystals that can be seen with just your eyes, what type of igneous texture
marysya [2.9K]
Glassy, because of the crystals being clear and shiny and fast cooling 


5 0
3 years ago
) The stem of a plant is growing upward while the roots grow downward. Which of these stimuli correctly describes the response o
Dafna1 [17]

Answer:

The correct answer is ''gravity.''

Explanation:

Tropisms are movements or changes in posture that a living being normally makes in response to a continuous environmental stimulus. Plants have hormones that respond to the gravitational impulse of our planet. Gravity deeply influences their growth and development (positive geotropism) and plants have been found to bend in response to gravity due to redistribution of the plant hormone auxin at the root tip, so that auxin is redistributed to the underside of a root that grows when it is rotated 90 degrees, the stems will still grow upward, away from the center of the Earth (negative geotropism), just as roots will always grow in the reverse direction (positive geotropism).

5 0
3 years ago
Other questions:
  • How do plant get nutrients​
    6·2 answers
  • Which statement is true about the process of accretion?
    10·2 answers
  • Herman is a slim man who is 5 feet 10 inches tall and weighs 140 pounds. however, he has diabetes, a disease that usually occurs
    5·1 answer
  • what's the difference between a nerve cell at the end of repolarization and a nerve cell in the resting state
    6·2 answers
  • What is the main difference between logistic and exponential growth curves? a. Logistic growth curves never increase exponential
    14·2 answers
  • Which type of limiting factor does the seasonal drought in the serengeti plains affect
    15·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • The form of chemical bonding which is responsible for creating one water molecule is known as ??
    15·2 answers
  • Which photo synthetic process can occur at night?
    8·1 answer
  • How was the appearance of the disease causing bacteria (S strain) different from the harmless bacteria (R Strain)?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!