1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lora16 [44]
2 years ago
6

Urban sprawl occurs when _______.

Biology
2 answers:
dexar [7]2 years ago
5 0
A) cities spread out into the existing countryside.
loris [4]2 years ago
3 0
A) Cities spread out into the existing countryside.
You might be interested in
The pituitary gland is divided into _______ lobes.
Mnenie [13.5K]

The pituitary gland, otherwise known as the hypophysis cerebri, is a small gland that is about the size of a pea. It’s

often called the “master gland” because it produces the hormones that stimulate the function of other endocrine

glands. It’s located at the base of the brain on the hypothalamus and is divided into two lobes—<u>anterior lobe and </u>

<u>posterior lobe. </u>

5 0
3 years ago
Read 2 more answers
A ________ is where one network ends and another begins.
umka21 [38]

A demarc is where one network ends and another begins. Demarc stands for demarcation point. It is the physical point at which the public network of a telecommunications company ends and the private network of a customer begins.

However, the distinction between where one category of network begins and another ends is sometimes blurry.

6 0
2 years ago
Main function of the digestive system
katovenus [111]
Breaking down food into smaller molecules. Absorbsion of nutriets taking place in the small intestine and elimination of waste products through the large intestine/ Colon
7 0
3 years ago
How will you ensure that ecological balance is maintained in your ecosystem?
posledela

Explanation:

Taking steps to reduce or eliminate pollution from nonpoint sources such as streets and farms will help to maintain the ecological balance. Sewage and run-off of agricultural fertilizer can cause the rapid growth of algae in lakes and streams. The growth of algae blocks sunlight and depletes the oxygen in the water.

4 0
2 years ago
Read 2 more answers
Why is it important that the seedling’s true leaves grow quickly?HURRY IM BEING TIMED
tankabanditka [31]

Answer:

The correct answer is - to make food for the seedling’s continued growth.

Explanation:

The true leaves that emerge from the seedlings are the leaves that are capable of performing photosynthesis and start generating food and energy. These support the plant for the rest of its life in terms of food and energy.

Seedlings grow from the soil, two leaves in beginning called cotyledons that are not the true leaves and not able to perform photosynthesis and generate their food for the seedling’s continued growth.

6 0
2 years ago
Other questions:
  • Give an example of a scientific investigation that would require both observations and experiments
    10·1 answer
  • Increase blood pressure <br> Increase blood volume <br> Decrease blood volume
    13·1 answer
  • A biologist ground up some plant leaf cells and then centrifuged the mixture to fractionate the organelles. Organelles in one of
    8·1 answer
  • What do we call a molecule that has a ratio of two hydrogen atoms for every one atom of carbon and oxygen?
    7·1 answer
  • How to solve this please
    9·1 answer
  • Why do we need a universal name for an organism?
    8·1 answer
  • What happens to air mass due to temperature?
    10·1 answer
  • And instrument to measure heart beat​
    10·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Which body system breaks down food into nutrients.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!