1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katrin2010 [14]
2 years ago
6

Which cell express higher levels of genetic variation

Biology
1 answer:
Mashutka [201]2 years ago
8 0

Answer:

mutation, recombination, and immigration of genes.

You might be interested in
What are the SI units of measurement (in science)
slamgirl [31]

Answer:

The units and their physical quantities are the second for time, the metre for measurement of length, the kilogram for mass, the ampere for electric current, the kelvin for temperature, the mole for amount of substance, and the candela for luminous intensity.

3 0
3 years ago
Read 2 more answers
Which policy would most likely decrease a city's gasoline use <br>​
Daniel [21]

Make sure the gas cap is on tight. One reason you may not be getting the mileage you expect is because there isn't as much gas in your tank as you think. 147 million gallons of gas were lost last year due to evaporation. Why did it evaporate? The gas cap was not on tight. So just make sure it is tight, and it will enable you to keep all the gas you pay for

4 0
3 years ago
When using a dichotomous key, it is important to always
sashaice [31]

Answer: answer is C

Explanation:

7 0
3 years ago
Read 2 more answers
Describe Protein denaturation and it's effects
hammer [34]

Answer: Denaturation involves the breaking of many of the weak linkages, or bonds (e.g., hydrogen bonds), within a protein molecule that are responsible for the highly ordered structure of the protein in its natural (native) state. Denatured proteins have a looser, more random structure; most are insoluble Denaturation involves the breaking of many of the weak linkages, or bonds (e.g., hydrogen bonds), within a protein molecule that are responsible for the highly ordered structure of the protein in its natural (native) state.

Explanation:

6 0
2 years ago
Please help. ASAP. I need an answer!! Ty.
Mandarinka [93]

Answer:

It is the varying chemical structure and properties of the R-group that make the amino acids different from one another. About 9 amino acids have non-polar R-groups and are relatively hydrophobic. Another 6 amino acids have strongly polar R-groups which readily attract water molecules.

7 0
2 years ago
Read 2 more answers
Other questions:
  • An example of working memory is
    10·1 answer
  • Public controversies may occur over a well-established scientific theory. Such controversies are particularly likely to arise wh
    9·1 answer
  • 2. Which of the following statements most correctly defines homeostasis? A. All living organisms are alike. B. Living organisms
    6·1 answer
  • What stage of mitosis do new nuclei form around the chromatin of the two new forming cells
    15·1 answer
  • 1,2,3,4 which one is the correct answer .?
    7·2 answers
  • How do land animals create methane?
    8·1 answer
  • When you by strawberry is "TEXTURE " matters? and why is that?
    13·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Choose the correct combination to link each part to its function
    15·1 answer
  • Can some help me please I can’t figure this out
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!