Answer:
The Trees changed color due to the pollution caused by the industries,it was not natural.When the white moths started standing out of the dark color of the trees they were eaten while the darker moths were saved and eventually all the white moths went extinct and the darker moths made more of their own kind
Explanation:
<h2>HER2 is Cancer cells of breast caner</h2>
Explanation:
- HER2 is a development advancing protein outwardly of all bosom cells.These malignancies will in general develop and spread quicker than other bosom diseases, yet are significantly more liable to react to treatment with drugs that focus on the HER2 protein.
- It isn't clear in the event that one test is more precise than the other, however, FISH is increasingly costly and takes more time to get the outcomes.
- In the event that the IHC result is 3+, the malignant growth is HER2-positive. This implies the HER2 status should be tried with FISH to explain the outcome.
- Triple-negative bosom tumors have relatively little HER2 and furthermore don't have estrogen or progesterone receptors. Hormone treatment and medications that target HER2 are not useful in treating these malignant growths.
- Hence, the answer of information of cancer treatment is "true"
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
