1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
leonid [27]
3 years ago
7

The sweet potato is a common crop plant found in most warm areas of the world. The plant rarely flowers and more rarely makes se

eds. However, the roots and potato vines spread rapidly, and new plants are easily grown from the roots and vines of old plants. Some scientists would like to grow new types of sweet potatoes that parasites will not attack. Which of these processes is most difficult in developing new types of sweet potatoes?
Biology
2 answers:
lidiya [134]3 years ago
8 0

Answer:

the potato vines spreading rapidly

GuDViN [60]3 years ago
6 0

Answer:

selective breeding

Explanation:

You might be interested in
Explain why the change in color of the peppered moths in response to the
GarryVolchara [31]

Answer:

The Trees changed color due to the pollution caused by the industries,it was not natural.When the white moths started standing out of the dark color of the trees they were eaten while the darker moths were saved and eventually all the white moths went extinct and the darker moths made more of their own kind

Explanation:

4 0
3 years ago
Read 2 more answers
What will happen if you heat a liquid to high temperatures?
likoan [24]
It will become a gas
6 0
3 years ago
Read 2 more answers
Scientists have observed that pythons have vestigial leg bones they have also observed that snakes in general have more DNA sequ
valentinak56 [21]
I think the answer is C hope this helps 
7 0
3 years ago
Particular receptor tyrosine kinases (RTKs) that promote excessive cell division are found at high levels on various cancer cell
Wittaler [7]
<h2>HER2 is Cancer cells of breast caner</h2>

Explanation:

  • HER2 is a development advancing protein outwardly of all bosom cells.These malignancies will in general develop and spread quicker than other bosom diseases, yet are significantly more liable to react to treatment with drugs that focus on the HER2 protein.
  • It isn't clear in the event that one test is more precise than the other, however, FISH is increasingly costly and takes more time to get the outcomes.
  • In the event that the IHC result is 3+, the malignant growth is HER2-positive. This implies the HER2 status should be tried with FISH to explain the outcome.
  • Triple-negative bosom tumors have relatively little HER2 and furthermore don't have estrogen or progesterone receptors. Hormone treatment and medications that target HER2 are not useful in treating these malignant growths.
  • Hence, the answer of information of cancer treatment is "true"

7 0
4 years ago
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
Other questions:
  • A population of giraffes on a square kilometer of the African savannah contains sixteen individuals. Generally, the giraffes sta
    10·2 answers
  • 4. Different restriction enzymes cut the same DNA molecule into different
    12·1 answer
  • Mass in motion is also know as
    8·2 answers
  • Which molecule is called the "molecule of hereditary?​
    5·2 answers
  • What can you learn from a set of embryo drawings of vertebrates of different phyla? A) the genotype of the species of different
    12·1 answer
  • Which compound is the strongest acid? H2S HBr Li2O LiBr
    12·1 answer
  • In what part of organic compounds is energy stored ?
    7·2 answers
  • Question 5
    11·2 answers
  • In 1973, biologist Theodosius Dobzhansky wrote an essay titled "Nothing in Biology Makes Sense Except in the Light of
    9·1 answer
  • When a volcano erupts, such as the Kilauea volcano in Hawaii, what do you think happens to the surrounding ecosystem? Explain ho
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!