1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kiruha [24]
3 years ago
11

What was Galileo‘s contribution to the study of motion

Biology
1 answer:
amid [387]3 years ago
5 0

Answer: In the midst of his busy life he continued his research on motion, and by 1609 he had determined that the distance fallen by a body is proportional to the square of the elapsed time (the law of falling bodies.)

You might be interested in
In which Colorado Rockies scenario was there more erosion? Why was there more erosion in the scenario?
Pavlova-9 [17]

Answer:

There was more erosion in the Colorado Rockies scenario where there was steady rain compared to the scenario in the same area where there was only a drizzle. There is more erosion because the steady rain increased the volume of the river more than the drizzle did. Because there was more water added to the river, the river flowed faster. The faster a river flows, the more sediments it transports or erodes.

Explanation:

hope this helps<3

8 0
2 years ago
Read 2 more answers
If a 2 kg ball is traveling at a speed of 4 m/s, what is its kinetic energy?
MariettaO [177]

Answer:

  • Option D is the correct answer.

Explanation:

It is given that a 2 kg ball is traveling at a speed of 4 m/s, so we have to find its kinetic energy.

KE = 1/2 mv²

KE = 1/2 × 2×(4)²

KE = 1/2 × 2×16

KE = 16 J

<u>Some information about Kinetic Energy</u>.

Kinetic Energy is the energy an object has because of its motion. It is directly proportional to the velocity of the particle and its mass. Kinetic energy is given by,

  • KE = ½mv²
  • It occurs due to the motion of the particle.
  • If a particle at rest position, then the kinetic energy will be zero because that particle won't be accelerating.
6 0
3 years ago
Which type of sickle sell is anemia
Sidana [21]

Hemoglobin SS and sickle beta zero thalassemia are the most severe forms of sickle-cell disease and are sometimes referred to as sickle cell anemia. Hemoglobin SC disease is considered moderate and in general, sickle beta plus thalassemia is the mildest form of sickle-cell disease.

:333

3 0
3 years ago
Read 2 more answers
Which of the following factors would have the smallest impact on a populationÍs size? a. the total number of organisms b. the av
Soloha48 [4]
"Adequate shelter" is the one among the following choices given in the question that <span>would have the smallest impact on a populations size. The correct option among all the options that are given in the question is the fourth option or option "d". I hope that this is the answer that has come to your help.</span>
4 0
3 years ago
A student argues that two species of birds are the same species because they have similar body structures, similar DNA, and simi
ArbitrLikvidat [17]

<u>Answer:</u>

"The birds have different mating seasons" piece of evidence supports the second student's argument.

<u>Explanation:</u>

The precise timing for bird sets to successfully match varies, and the timing for distinct species develops to give the consequent chicks the best chance of survival. Speciation is the mechanism through which new species are produced. This happens when classes within an individual are separated and diverge reproductively.

Organisms contribute to the same group as per the biological species definition if they can reproduce in order to create healthy, fertile offspring. Group are divided by prezygotic and postzygotic restrictions which prevent mating or producing viable, fertile offspring from each other.

7 0
3 years ago
Read 2 more answers
Other questions:
  • Ramona and her family agree that what got Ramona through law school is what got her through obstacles all her life: her belief i
    15·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • James suffers a heart attack. His heartbeat and breathing have stopped completely. How would you help him?
    15·2 answers
  • Why is sugar a simple carbohydrate
    6·1 answer
  • What is the difference in trophic level efficiency between herbivores and carnivores.
    11·2 answers
  • A communications satellite transmits a radio wave at a frequency of 9.4 x 10^9 Hz. What is the signal’s wavelength? Assume the w
    5·1 answer
  • Where do nutrients enter the body?
    11·2 answers
  • What is noice pullotion. <br>pls po pasagot ;23 point po ​
    9·1 answer
  • HELP ASAP!!!
    8·2 answers
  • Fetal lung maturity can be determined from amniotic fluid because the surfactant is PRIMARILY composed of:
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!