1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lerok [7]
3 years ago
14

The energy stored in food molecules in living cells is gradually released in a series of linked chemical reactions called a ____

________.
Biology
1 answer:
Mademuasel [1]3 years ago
5 0
Respiration - The cellular process of releasing energy from food through a series of enzyme-controlled reactions is called respiration . Some of the energy released is used to produce ATP.
You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
Help me right now! Write an explanation of the benefits/ harmful uses of Zebra Mussel
Nady [450]

Answer:

Zebra mussels negatively impact ecosystems in many ways. They filter out algae that native species need for food and they attach to--and incapacitate--native mussels. Power plants must also spend millions of dollars removing zebra mussels from clogged water intakes.

Explanation:

3 0
2 years ago
Describe a phase of mitosis?
zimovet [89]
Mitosis ends with 2 identical cells, each with 2N chromosomes and 2X DNA content. All eukaryotic cells replicate with mitosis-except germline cells that undergo meiosis to produce gametes (eggs and sperm)).
5 0
2 years ago
When NADH passes its electrons into the Electron Transport System, NADH is chemically:
erik [133]

Answer:

Option D, oxidized

Explanation:

The NADH gets oxidised when it passes its electrons into the Electron Transport System

Oxidization is a process in which one element or compound loses its electron to other chemical element or compound thereby itself getting oxidised and reducing the other one (the one who gains the electron).

Here in the electron transport system, the NADH loses or donates its electron to the Electron Transport System thus chemically it gets oxidized.

Hence, option D is correct

8 0
3 years ago
Explain (1) what type of variation is always required for natural selection and (2) where this variation comes from?
larisa86 [58]

When we talk about evolution we come across the process of natural selection. Genetic variation is always required for the natural selection. A change or variation in the genes may help the individuals in a population to better adapt to the environment. Such changes may be brought by mutations or random mating in the population. Such variations help in the survival of the population by allowing them to adapt to changing environmental conditions.

4 0
3 years ago
Other questions:
  • How does the respiratory center in the brain control breathing rate?
    7·1 answer
  • Which statement about green plants is true?
    15·2 answers
  • A teenager with allergies is using oxymetazoline (afrin) nasal spray. what effect should the nurse evaluate the client for if mo
    7·1 answer
  • Macrophages are white blood cells that roam the body searching for invading microbes. inside macrophage vacuoles these invaders
    12·1 answer
  • An individual’s behavior characteristics, emotional expression, and intensity that is established from birth is known as _______
    8·2 answers
  • Protein structures have several different levels of organization. The primary structure of a sequence. The secondary and tertiar
    9·1 answer
  • How is carbon taken out of the atmosphere ?
    12·1 answer
  • I don't what it wants me to answer, if you understand it please help​
    5·1 answer
  • How are evaporation and condensation similar?​
    5·2 answers
  • Question 6(Multiple Choice Worth
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!